Journal of Histochemistry and Cytochemistry Priciples for Free Access to Science
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haqqani, A. S.
Right arrow Articles by Birnboim, H. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haqqani, A. S.
Right arrow Articles by Birnboim, H. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Journal of Histochemistry and Cytochemistry, Vol. 47, 1563-1574, December 1999, Copyright © 1999, The Histochemical Society, Inc.


ARTICLE

Characterization of a Polyclonal Antibody to Human Thymidylate Synthase Suitable for the Study of Colorectal Cancer Specimens

Arsalan S. Haqqania, Randy T. Cowlinga, Jean A. Marounb, and H. Chaim Birnboima,b
a Department of Biochemistry, Microbiology and Immunology, Ottawa, Ontario, Canada
b University of Ottawa, and the Ottawa Regional Cancer Centre, Ottawa, Ontario, Canada

Correspondence to: H. Chaim Birnboim, Ottawa Regional Cancer Centre, 501 Smyth Road, Ottawa, Ontario, Canada K1H 8L6


*   Summary
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Measurement of thymidylate synthase (hTS) using immunohistochemical techniques has been reported in several clinical studies. However, its value as a prognostic indicator is still not clear. To pursue this, we have developed a new rabbit polyclonal antibody, hTS7.4. The antigen was recombinant hTS containing an N-terminal His6-tag. Antiserum hTS7.4 detected recombinant hTS by ELISA at a titer of 1:100,000. Western blot analysis of several human cell lines showed a single band of the expected 36-kD molecular size. HeLa cells treated with the TS inhibitor 5-FUdR showed the expected additional band corresponding to the ternary complex of hTS-dFUMP-reduced folate. hTS7.4 detected TS in bacterial, rat, mouse, and monkey cell extracts, and hTS8.3 (a closely related antiserum) immunoprecipitated a 36-kD [35S]-methionine-labeled protein from HeLa extracts. TS was detectable by indirect immunofluorescence in HeLa cells. Proliferating normal human fibroblasts in culture showed staining, but nonproliferating cells did not. Lymphocytes in the germinal center of human tonsil tissue, which are known to be proliferating, stained with hTS7.4 and also with monoclonal antibody TS106. TS may therefore be useful as an immunohistochemical marker of cell proliferation. Normal colon mucosa showed weak staining, whereas some colorectal cancer specimens stained very strongly with hTS7.4. A clinical study of colorectal cancer using this antibody is in progress. (J Histochem Cytochem 47:1563–1573, 1999)

Key Words: thymidylate synthase, polyclonal antibody, Western blot, immunohistochemistry, human, colorectal cancer, cell proliferation marker


*   Introduction
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Thymidylate synthase (TS) (EC 2.1.1.45) converts deoxyuridine 5'-monophosphate (dUMP) to thymidine 5'-monophosphate (dTMP), the precursor to thymidine 5'-triphosphate (TTP), one of the four deoxynucleoside triphosphates essential for DNA synthesis. Because inhibition of TS prevents DNA synthesis and cell proliferation, the enzyme is an important target for cancer chemotherapeutic drugs (Rustum et al. 1997 Down). 5-Fluorouracil (5-FU) and 5-fluorodeoxyuridine (5-FUdR) are examples of TS inhibitors that are clinically useful in the treatment of colorectal and other cancers (Rodriguez–Bigas et al. 1993). These nucleoside analogues are converted to FdUMP, which inhibits TS by forming a stable ternary complex with methylene tetrahydrofolate (CH2THF) (Drake et al. 1993 Down), leading to cytotoxicity.

TS has been extensively investigated as a prognostic molecular marker in a variety of cancers (Johnston et al. 1994 Down, Johnston et al. 1995 Down; Pestalozzi et al. 1997 Down; Suzuki et al. 1994 Down; Findlay et al. 1997 Down; Leichman et al. 1997 Down; Sanguedolce et al. 1995 Down; Gorlick et al. 1998 Down; Kuniyasu et al. 1998 Down; Yamachika et al. 1998 Down; Yeh et al. 1998 Down). Some studies have found that high levels of TS protein in patients with colorectal, gastric, breast, and ovarian cancers are positively correlated with poorer survival and/or poorer response to 5-FU. Others found no such correlations. Many of the studies were carried out using a single well-characterized monoclonal antibody (TS106) (Johnston et al. 1991 Down; Behan et al. 1998 Down). Although several anti-TS polyclonal antibodies have been described, the detailed characterization of only one has been reported (Okabe et al. 1997 Down). We therefore undertook to develop and extensively characterize a polyclonal antibody that could be used for clinical studies. The properties of anti-thymidylate synthase antibody hTS7.4 are described, including its application to fixed human colorectal cancer and normal tonsil samples.


*   Materials and Methods
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Construction of pQE-hTS and pcDNA3/HA-hTS29
A human TS cDNA (pUC19.TS4) was obtained from D. Santi (University of California, San Francisco). This plasmid appeared to be derived from pDHTS-S1 (Davisson et al. 1989 Down). The first 90 nucleotides of the coding region correspond to the changes in codon usage introduced by these workers to enhance bacterial expression. The resultant amino acid sequence is unchanged. From this plasmid, a 938-bp fragment was generated using PCR (forward primer GCGAGCTCGGAGCTGCC; reverse primer GCACCCTAAACAGCCATTTCC). This fragment, spanning nucleotides 25–942 of the hTS open reading frame and five nucleotides of the 3' UTR, created a Sac I restriction site at the 5' end. The fragment was digested with Sac I. An IPTG-inducible bacterial expression vector pQE-31 (Qiagen; Mississauga, Ontario, Canada) was digested with Sma I, T-tailed with Taq DNA polymerase/dTTP, and then digested with Sac I. The PCR fragment was ligated to this vector. On IPTG-induction, the construct (pQE-hTS) expressed recombinant hTS protein lacking the first five N-terminal amino acids (MPVAG) and containing 16 additional N-terminal amino acids (MRGSHHHHHHTDPHAS), which includes a (His)6 tag. pQE-hTS was introduced into E. coli M-15 [pREP4] (Qiagen) and plated on LB-agar plates containing ampicillin (100 µg/ml) and kanamycin (25 µg/ml). Ten colonies were selected and screened by small-scale IPTG induction for the presence of a 36-kD recombinant protein on Coomassie Blue-stained SDS-PAGE. The clone showing the strongest induction was selected for large-scale hTS purification.

pcDNA3/HA-hTS29 is a pcDNA3-based (Invitrogen; Carlsbad, CA) construct that encodes a 29-kD truncated form of hTS into which a hemagglutinin (HA) tag was introduced at the N-terminus (Cowling et al. 1998).

Ni-NTA-purified (His)6-tagged hTS
pQE-hTS-transformed M-15 [pREP4] cells were grown to an A600 of 0.7 in 500 ml 2 x YT broth containing ampicillin (100 µg/ml) and kanamycin (25 µg/ml) with vigorous shaking at 37C and then induced with 2 mM IPTG for 5 hr. Cells were collected by centrifugation (5000 x g) and the cell pellet was dissolved directly in 30 ml GPT [6 M guanidinium chloride, 0.1 M sodium phosphate, 0.01 M Tris-HCl (pH 8)], then incubated for 1 hr at room temperature (RT). The mixture was cleared by centrifugation (11,000 x g) and the supernatant was loaded onto an Ni-NTA agarose column (Qiagen) (4 ml bed volume) pre-equilibrated with GPT. The column was washed sequentially with (a) 10 column volumes of GPT (b) 8 M urea, 0.1 M sodium phosphate, 0.01 M Tris-HCl (pH 8.0) until the A280 of the eluate was <0.01, then (c) 8 M urea, 0.1 M sodium phosphate (pH 6.3) until the A280 of the eluate was <0.01. Bound protein was eluted with SDS buffer (2% SDS, 10 mM CDTA, 0.1 M sodium phosphate, pH 7.0) in 1 ml fractions. CDTA is cyclohexanediamine tetraacetate (Sigma-Aldrich; Oakville, Ontario, Canada). Fractions were analyzed by SDS-PAGE (Laemmli 1970 Down) and stained with Coomassie Blue. The estimated recovery of hTS protein was 8 mg.

Gel-purified hTS
His6-tagged hTS protein (1 mg) recovered from the Ni-NTA column was electrophoresed on SDS-PAGE using a Bio-Rad Protean II apparatus (Bio-Rad; Mississauga, Ontario, Canada) and then stained with Coomassie Blue. The 36-kD band was cut from the gel and the protein recovered by electroelution using Bio-Rad Electro-Eluter Model 422 in 8 mM Tris-base, 4 mM sodium acetate, 0.1% SDS, 0.2 mM CDTA (pH 8) at 10 mA for 2 hr. The electroeluted protein was precipitated with 4 volumes ethanol (2 hr at -20C), redissolved in SDS buffer, and subjected to a second round of electrophoresis on SDS-PAGE as above. Yield of the pure hTS protein was estimated to be 40–50% and purity >99%.

Immunizations
Eight New Zealand White rabbits were used to test the effectiveness of immunization using different forms of Ni-NTA-purified hTS (240 µg per rabbit) administered by different routes. Preimmune serum was taken from all rabbits before the primary injection. Different methods of immunization were tested, of which the best results (based on ELISA titers) were achieved as follows. The protein was ethanol-precipitated, redissolved in 0.1 M NaOH, partially hydrolyzed (10–13-kD peptides as assessed by SDS-PAGE) by heating at 100C for 20 min, neutralized with acetic acid, and emulsified in an equal volume of complete Freund's adjuvant (Difco; Detroit, MI). Rabbits #7 and #8 received IM injections at two sites. The first bleed was 12 days after primary injections and the antisera were screened for reactivity towards Ni-NTA-purified hTS by ELISA. These same rabbits were boosted twice with the same form and amount of immunogen as used for the primary injections at 4–5-week intervals, except that incomplete Freund's adjuvant was used. Ten days after each boost, blood samples (second and third bleed) were collected and the antisera were assayed by ELISA and Western blotting. Rabbit #8 was exanguinated at the time of the third bleed (antiserum hTS8.3). Rabbit #7 was maintained for 8 months after the third bleed and then boosted a third time with 50 µg of gel-purified hTS protein in the presence of incomplete Freund's adjuvant (Difco). This rabbit was exsanguinated 10 days after the boost and the antiserum (hTS7.4) was assayed by ELISA for reactivity towards gel-purified hTS.

ELISA
Wells of a 96-well polystyrene microtiter plate were coated by adding 50 µl per well of 20 µg/ml gel-purified hTS in 0.1 N NaOH and incubating overnight at RT. Wells were washed three times with ELISA buffer (0.02 M Tris-HCl, pH 7.5, 0.15 M NaCl, 0.05% v/v Tween-20) and then blocked by incubating with 2% bovine serum albumin (BSA) for 2 hr. Appropriately diluted primary antibodies (rabbit TS antiserum or rabbit preimmune serum) in ELISA buffer (100 µl per well) were then added to both the TS-coated and noncoated wells for 1 hr at 37C. Wells were washed three times with ELISA buffer to remove unbound antiserum. Secondary antibody, 1:1000 diluted phosphatase-conjugated goat anti-rabbit IgG (Kirkegaard & Perry; Gaithersburg, MD) (100 µl per well) was added and incubated for 1 hr at 37C. Wells were washed three times with ELISA buffer, and 100 µl per well of substrate [1 mg/ml p-nitrophenyl phosphate (Sigma–Aldrich) in 10% v/v ethanolamine, 0.5 mM MgCl2, pH 9.8] was added. The reaction was stopped after 20 min by addition of 100 µl of 0.1 M CDTA, and the absorbance of the reaction was measured at 405 nm in a Benchmark Microplate Reader (Bio-Rad). For correction of nonspecific binding, the absorbance of the noncoated wells was subtracted from the absorbance of corresponding TS-coated wells. Each assay was performed at least in triplicate.

Preadsorbed (hTS7.4p) and Affinity-purified (hTS7.4a) TS7.4 Antiserum
A total of 0.5 g of cyanogen bromide-activated Sepharose 4B (Pharmacia Biotech; Baie d'Urfe, Quebec, Canada) (pre-swollen and washed in 1 mM HCl) was incubated with 0.5 mg of gel-purified hTS in 2.5 ml coupling solution (0.1 M NaHCO3, 0.5 M NaCl, pH 8.3) overnight at 4C. The beads were then washed with 2 vol coupling solution and the residual active groups were blocked with 4 vol 0.1 M Tris-HCl, pH 8.0, by incubation for 2 hr at RT. The beads were transferred to a column and washed for three cycles, alternating with 0.1 M sodium acetate, 0.5 M NaCl, pH 4.0, followed by 0.1 M Tris-HCl, 0.5 M NaCl, pH 8.0. The column was finally equilibrated with 0.01 M Tris-HCl (pH 7.5). Diluted hTS7.4 antiserum (1:10 in 1 ml of 0.01 M Tris-HCl, pH 7.5) was passed through the column a total of five times. The final flow-through was designated hTS7.4p. Antibody recovered from the column in 0.1 M glycine buffer at pH 2.5 was designated hTS7.4a; about 50% of the bound hTS7.4 was recovered, as determined by ELISA. As a control, diluted hTS7.4 antiserum was passed through a similar Sepharose 4B column to which BSA was coupled.

Western Blot Analysis
Cells were lysed in lysis buffer (0.5% Triton X-100, 1 mM CDTA, 1 mM PMSF, 1 mg/ml aprotinin, 20 mM MOPS, pH 7.2), incubated for 30 min on ice, and centrifuged at 14,000 x g for 20 min. Extracts were diluted in SDS sample buffer (2% SDS, 10% glycerol, 1% 2-mercaptoethanol, 0.0005% bromophenol blue, 125 mM MOPS, pH 6.8), and heated at 100C for 5 min. Protein was quantified by fluorescamine (Udenfriend et al. 1972 Down) (Sigma–Aldrich), an amine-reactive fluorophore, as described elsewhere (De Vouge et al. 1994 Down). Extracts were resolved on 12% discontinuous SDS-PAGE and elecrophoretically transferred to PVDF membranes (Millipore; Nepean, Canada) at 15 V for 18 hr in a solution of 3 mM Na2CO3, 10 mM NaHCO3, and 10% methanol. The membranes were Ponceau S-stained to detect the standards, washed twice in TBST (10 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 8), and then blocked with BSA (1%) for 30–45 min. Primary antibodies were diluted in TBST and incubated with the membranes for 1 hr. The membranes were washed three times in TBST and then incubated for 1 hr with secondary antibody (alkaline phosphatase-linked goat anti-rabbit IgG) diluted 1:1000 in TBST. The membranes were washed three times in TBST and then developed by using either BCIP/NBT substrate (Sigma-Aldrich) or a chemiluminescent substrate, CSPD (Boehringer–Mannheim; Laval, Quebec, Canada).

Immunoprecipitation
HeLa cells (1.2 x 106 in a 10-cm dish) were incubated for 6.5 hr in DMEM lacking L-methionine and L-cysteine and containing 100 µCi L-[35S]-methionine (Sigma–Aldrich). Cells were washed and lysed in 200 µl lysis buffer. After incubation for 30 min at 0°C, the lysate was clarified by centrifugation at 14,000 x g for 20 min. The supernatant was first incubated with preimmune serum (1:10) of rabbit #8 for 1 hr at 4C and then with protein A–Sepharose (Sigma–Aldrich) for 30 min at 4C. Beads were removed by centrifugation and the supernatant was incubated with fresh protein A–Sepharose for 30 min at 4C. After removing the beads, the supernatant was incubated with a 1:500 dilution of hTS-8.3 antiserum or with a 1:500 dilution of preimmune serum for 1 hr at 4C. The extracts were incubated with protein A–Sepharose for 1 hr at 4C and the beads collected by centrifugation. The beads were washed three times in lysis buffer and bound protein was recovered for PAGE analysis by boiling for 2 min in SDS sample buffer. An equal number of 35S counts taken from each of these fractions, as well as from the original nonimmunoprecipitated extract, were loaded on SDS-PAGE (12%). Radiolabeled proteins were visualized by exposure to Kodak XAR film for 3 days at -80C.

Immunofluorescence of Cultured Cells
HeLa or COS-1 cells (3 x 104 per 3-cm dish) were grown on coverslips for 72 hr, washed four times with PBS, and fixed with methanol:acetone (1:1) for 5 min at RT. Fixed cells were then rinsed twice in PBS and incubated for 1 hr with primary antibodies (hTS7.4 antisera, preimmune rabbit sera, or mouse anti-HA (Boehringer–Mannheim) diluted in Ab buffer (0.05% Tween-20, 1% BSA, 5% goat serum, 150 mM NaCl, 50 mM Tris-HCl, pH 7.5). The cells were washed three times in PBS and then the rabbit antisera were detected with FITC-conjugated anti-rabbit IgG (Cedarlane; Hornby, Ontario, Canada) (1:500 dilution, 1-hr incubation), while the mouse monoclonal anti-HA antibody was reacted with biotinylated goat anti-mouse IgG (Cedarlane) (1:500 dilution, 1-hr incubation) and then stained with Texas Red-conjugated streptavidin (Cedarlane) (1:500 dilution, 1-hr incubation). After three washes with PBS, the slides were mounted and examined by fluorescence microscopy.

Immunohistochemistry of Fixed Cells
Cultures of human fibroblasts (2.5 x 105 per 3-cm dish containing a sterile glass coverslip) were grown to confluency and then incubated for a further 2 days. Areas of the confluent monolayer culture were wounded with a sterile pipette tip to disrupt the monolayer and then cells were incubated for an additional 18 hr. The coverslips were washed four times with PBS and fixed in GenoFix, a methanol-based tissue fixative (DNA GenoTek; Montreal, Quebec, Canada) for 15 min at RT. Fixed cells were rinsed four times with PBS and incubated in suppressor solution (20% normal goat serum, 4% BSA, 1% normal swine serum, 0.1% NP-40, and 10% sucrose in PBS). After 20 min, primary antibodies (hTS7.4 or hTS7.4p) were diluted 1:300 in antibody diluent (1% BSA, 0.1% NP-40, and 10% sucrose in PBS) and added to the cells. After 1-hr incubation, the primary antibody was removed by washing three times in PBS and the cells were incubated with biotin-conjugated goat anti-rabbit IgG (Vector; Burlingame, CA) for 20 min. Cells were washed three times in PBS and incubated with horseradish peroxidase-conjugated avidin D (Vector). After 20 min, cells were washed three times in PBS and incubated with diaminobenzidine substrate (0.5 mM diaminobenzidine, 7 mM hydrogen peroxide) for 10 min. The cells were finally washed three times in distilled H2O, dehydrated three times in ethanol, cleared three times in toluene, and mounted to glass slides using Permount (Fisher; Fair Lawn, NJ).

Immunohistochemistry of Human Tissue
Colorectal cancer specimens were from the Ottawa Colorectal Cancer Bank; most were fixed in GenoFix, a methanol-based tissue fixative (DNA GenoTek). Four-µm sections were deparaffinized and hydrated by standard methods. Slides were heated in 10 mM citrate buffer (pH 6) in a microwave oven, blocked with suppressor solution, exposed overnight at RT to 1:300 dilution of hTS7.4 antiserum, then to peroxidase-linked anti-rabbit/anti-mouse immunoglobulin antibody (polymer from DAKO; Carpinteria, CA) for 30 min. Avidin-based detection was avoided because high tissue biotin-like material was encountered in many colorectal samples. Color development used diaminobenzidine substrate and sections were counterstained with hematoxylin. Human tonsil tissue, fixed in formalin, was similarly treated using 1:150 dilution of hTS7.4 or 1:20 dilution of 1 mg/ml anti-TS monoclonal antibody TS106 (Chemicon International).

TS Activity Assay
Extracts of bacterial cells containing the inducible expression vector, pQE-hTS, were tested for inducible TS activity. Two 50-ml 2 x YT cultures (containing ampicillin and kanamycin) were inoculated with an overnight culture of pQE-hTS in M-15 (pREP4). When the A600 reached 0.7, one culture was incubated with 2 mM IPTG (induced) and the other without (uninduced) for 3 hr. Cells were harvested, lysed by sonication in sonication buffer [300 mM NaCl/50 mM sodium phosphate (pH 7.8)] and centrifuged at 11,000 x g for 10 min at 4C. The supernatant (soluble fraction) was removed and the pellet was suspended in 5 ml of sonication buffer and resonicated (insoluble fraction). Both fractions were analyzed for TS enzymatic activity using a spectrophotometric assay based on the oxidation of CH2THF to dihydrofolate, detected as an increase in absorbance at 340 nm (Reyes and Heidelberger 1965 Down). Reaction mixtures (1.0 ml) contained 10 µg of protein, 200 µM tetrahydrofolate (Sigma–Aldrich), 3.3 mM formaldehyde, and 50 mM ß-mercaptoethanol in 0.1 M phosphate buffer (pH 6.7). After 10-min preincubation at 37C, the initial A340 was measured, after which the reaction was started by adding 100 nmol dUMP; control reactions lacking dUMP were carried out in parallel. After 20 min incubation at 37C, the A340 was again measured. {Delta}A340 is the difference between A340 (final) and A340 (initial). The corrected {Delta}A340 is the difference between test and control reactions. One enzyme unit was defined as the formation of 1 µmol of dihydrofolate per min, which equals a corrected {Delta}A340 of 6.4 (Reyes and Heidelberger 1965 Down).

Cell Lines Employed
All cell lines were grown in Dulbecco's modified Eagle's medium (DMEM) plus 10% fetal calf serum (GIBCO BRL; Burlington, Ontario, Canada) in a humidified atmosphere of 5% CO2/95% O2 at 37C. Log phase cultures were used throughout except where otherwise indicated. Cell lines of human origin used in this study include HeLa, HL-60, and 293T cells (from ATCC; Rockville, MD). Human neutrophils were isolated as described (Cowling and Birnboim 1994 Down). COS-1 cells (ATCC) are of African green monkey origin. rOSE 199 cells are rat ovarian surface epithelium (Adams and Aversperg 1985) (obtained from B. Vanderhyden). MC17-51 are a mouse fibrosarcoma line (Wilkinson et al. 1995 Down). Where indicated, cell transfections were carried out using Lipofectamine (GIBCO BRL).


*   Results
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Purification of Immunogen
Recombinant human thymidylate synthase (hTS) expressed in E. coli was used to prepare a rabbit polyclonal antibody. The protein was expressed with six histidine residues at the N-terminus to allow it to be purified on an Ni2+ column. After induction with IPTG, the bacteria showed increased expression of a 36-kD protein, corresponding to the molecular mass of hTS monomer (Figure 1, Lanes 1 and 2). A prominent 35-kD band was seen in the absence of induction with IPTG, making it difficult to assess whether there was some "leaky" production of the 36-kD recombinant protein. To confirm that the induced protein was indeed thymidylate synthase, extracts of IPTG-induced and noninduced bacterial cells were analyzed for TS enzymatic activity (Table 1). The IPTG-induced culture showed 14-fold higher TS activity than the noninduced culture, confirming that the induced protein was indeed TS. TS enzymatic activity was also confirmed using a radioactive TS assay (Calvert et al. 1980 Down) (not shown). Whole cells from IPTG-induced cultures were solublized and His6-hTS was then purified by Ni2+-affinity chromatography. Peak A280 fractions eluted from the column were pooled and showed predominantly (>95%) a single 36-kD band, corresponding to hTS (Figure 1, Lane 3).



View larger version (99K):
[in this window]
[in a new window]
 
Figure 1. SDS-PAGE stained with Coomassie blue to detect recombinant hTS. Four µg of protein from bacterial cell extracts transformed with pQE-hTS plasmid was loaded in each lane. Bacterial cells were either not induced (Lane 1) or IPTG-induced (Lane 2) to express a 36-kD His6-tagged hTS protein that was affinity-purified by Ni-NTA (Lane 3) and by gel purification (Lane 4).


 
View this table:
[in this window]
[in a new window]
 
Table 1. Thymidylate synthase (TS) enzymatic activity in soluble and insoluble fractions of uninduced and induced E. coli cells expressing putative recombinant hTSa

Generation of Anti-TS Antiserum
Of four protocols tested in eight rabbits injected with recombinant hTS, the highest ELISA titer after the first injection was obtained by the procedure described in Materials and Methods. Immunization was continued in those two rabbits. Antisera collected 10 days after the third injection (hTS7.3 and hTS8.3) were titered by ELISA and Western blots. The highest dilution detectable by ELISA was 1:100,000 for both antisera. The highest dilution of both antisera that could detect a 36-kD protein band on a Western blot of a HeLa cell extract was 1:10,000 (not shown).

Both hTS7.3 and hTS8.3 antisera showed a low level of crossreactivity with proteins other than 36-kD TS protein. The following strategy was devised to further increase the specificity of the antiserum. Eight months after the third injection, rabbit #7 was injected with gel-purified hTS (Figure 1, Lane 4) and antiserum hTS7.4 was taken 10 days later. hTS7.4 was similar to hTS7.3 and hTS8.3 in that both detected recombinant hTS on ELISA up to 1:100,000 dilution and both detected a 36-kD band on Western blots of HeLa extracts up to 1:10,000 dilution (not shown). However, a Western blot comparing hTS7.3 and hTS7.4 at 1:1000 dilution produced a significantly lower background for the latter (Figure 2A; compare Lanes 1 and 2).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 2. Western blot analysis of HeLa cell extracts and purified His6-hTS protein. (A) HeLa cell extracts (5 µg protein per Lane) were probed with hTS7.3 (Lane 1), hTS7.4 (Lane 2), hTS7.4p (Lane 3), and hTS7.4a (Lane 4) antisera. (B) Extracts (5 µg protein per lane) from HeLa cells, either not treated (Lane 2) or treated with 10 µM FUdR for 24 hr (Lane 1), were probed with hTS7.4. (C) His6-chromodomain (5 µg), bovine serum albumin (4 µg), and His6-hTS (0.5 µg) proteins were Ponceau S-stained (Lane 1) and probed with hTS7.4 (Lane 2). Blots were detected with BCIP/NBT.

hTS7.4 Antiserum Specifically Detects TS on Western Blots
To confirm that the 36-kD band on Western blots of HeLa cell extracts (Figure 2A, Lane 2) was TS, hTS7.4 antiserum was depleted of hTS-specific antibodies by passing it through a column to which recombinant hTS was immobilized. hTS7.4p (preadsorbed hTS7.4) did not detect a 36-kD band (Figure 2A, Lane 3) and showed a 94% lower signal on ELISA compared to hTS7.4 (not shown). hTS7.4a (affinity-purified hTS7.4) produced similar results to hTS7.4 on Western blots (Figure 2A; compare Lanes 2 and 4). To show that the hTS affinity column was binding hTS7.4 specifically, hTS7.4 antiserum was passed through a column to which albumin was immobilized; the flow-through was identical to the untreated antiserum on a Western blot and in ELISA (not shown).

As an independent test of the identity of the 36-kD protein in HeLa cell extracts, cells were incubated with FUdR for 24 hr and cell lysates were probed on Western blots with hTS7.4 antiserum. A band shift, corresponding to the formation of a stable ternary complex of TS protein, FdUMP and CH2THF, was seen (Figure 2B), as described earlier (Johnston et al. 1991 Down).

Because hTS7.4 antiserum was raised using hTS tagged with six histidine residues at its amino terminus, there was the possibility that the antiserum might detect the His6 tag. This was tested by Western blotting against an unrelated His6-tagged protein (His6-chromodomain protein) (Figure 2C, Lane 2). No His6-chromodomain was detected, even though tenfold the amount of the 63-kD protein as His6-hTS was loaded.

hTS7.4 was compared to an anti-TS monoclonal antibody (TS106) that has recently become commercially available. Western blots of HeLa cell extracts probed with hTS7.4 and TS106 produced similar results. However, a fairly high concentration of TS106 (10 µg/ml; 1:100 of the 1 mg/ml solution supplied by Chemicon) was required to produce a 36-kD TS protein band of similar intensity to a 1:10,000 dilution of hTS7.4 antiserum (not shown).

Detection of TS in Other Cell Types by Western Blotting with hTS7.4
hTS7.4 was used to assess the TS levels in extracts of various human cells (Figure 3A). HeLa cells, 293T cells, and log-phase primary human skin fibroblasts had similar TS levels (Figure 3A, Lanes 1–3); HL-60 cells had about two times higher levels (Figure 3A, Lane 5). TS was barely detectable in 48-hr postconfluent fibroblasts (Figure 3A, Lane 4), and none was detectable in primary human peripheral blood neutrophils (Figure 3A, Lane 7). HL-60 cells that were treated for 3 days with retinoic acid to cause differentiation into a neutrophil-like cell type still showed high hTS levels (Figure 3A, Lane 6), but the expected disappearance of TS signal (as in neutrophil extracts) was not seen. The membrane was stripped and reprobed with anti-ß-tubulin antibody as a loading control. Although neutrophils showed little ß-tubulin, they did show other proteins when the membrane was stained with Ponceau S (not shown). 293T cells were transiently transfected with a construct (pcDNA3/HA-hTS29) expressing a truncated hTS protein tagged with hemagglutinin (HA) at the N-terminus. The 29-kD recombinant protein was detected by both HA and hTS7.4 antibodies on Western blots (Figure 3B, Lanes 2 and 4). These signals were absent in control (pcDNA3- transfected) 293T cells (Figure 3B, Lanes 1 and 3). Both the endogenous 36-kD hTS protein and the truncated 29-kD HA-hTS29 protein could be detected by hTS7.4 antiserum on the same blot (Figure 3B, Lanes 3 and 4).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 3. Western blot analysis of different cells with hTS7.4 antiserum. (A) Cell extracts (20 µg protein per lane) from HeLa (Lane 1), 293T (Lane 2), log-phase primary human skin fibroblasts (Lane 3), 48-hr postconfluent fibroblasts (Lane 4), HL-60 (Lane 5), HL-60 cells treated with 1 µM all-trans-retinoic acid for 3 days (Lane 6), and neutrophils (Lane 7) were probed with hTS7.4 (upper panel) or anti-tubulin (lower panel) antibody. (B) Five µg protein from extracts of 293T cells transiently transfected with pcDNA3-alone (Lanes 1 and 3) or pcDNA3/HA-hTS29 (Lanes 2 and 4) was probed with either anti-HA antibody (Lanes 1 and 2) or hTS7.4 (Lanes 3 and 4). (C) Extracts (5 µg protein per Lane) from E. coli SURE cells (Lane 1), rat OSE cells (Lane 2), mouse MC17-51 cells (Lane 3), African green monkey COS-1 cells (Lane 4), and human HeLa cells (Lane 5) were probed with hTS7.4. Arrows indicate the expected size of TS for the species. Blots were detected with CSPD (A) or BCIP/NBT (B,C).

hTS7.4 antiserum also detected TS protein in non-human species (Figure 3C). A band of the expected size for TS from that species (indicated by the arrows) was detected in extracts of proteins from E. coli (Figure 3C, Lane 1), rat cells (Figure 3C, Lane 2), mouse cells (Figure 3C, Lane 3) and African green monkey cells (Figure 3C, Lane 4), as well as HeLa cells (Figure 3C, Lane 5).

Immunocytochemistry with hTS7.4
We next addressed whether hTS7.4 could detect hTS protein in cultured cells. Immunofluorescence staining of fixed HeLa cells with 1:1000 hTS7.4 antiserum (Figure 4B) gave a cytoplasmic signal that was significantly higher than that seen using preimmune serum (Figure 4A). To further confirm that the antiserum was in fact detecting hTS in fixed cells, immunofluorescence was carried out on COS-1 cells transiently transfected with pcDNA3/HA-hTS29, the construct that expressed HA-tagged truncated hTS (Figure 4C–4E). These cells gave a very strong cytoplasmic signal with both anti-HA antibody (Figure 4C) and hTS7.4 (Figure 4D). COS-1 cells transfected with pcDNA3 vector did not stain with either hTS7.4 or anti-HA antibodies (not shown).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 4. Immunocytochemical analysis of cultured cells using hTS7.4 and anti-HA antibodies. Indirect immunofluorescence of HeLa cells with preimmune serum (A) or hTS7.4 antiserum (B) using FITC-labeled secondary antibody (magnification x400). (C–E) Double indirect immunofluorescence of COS-1 cells transiently transfected with pcDNA3/HA-hTS29 and stained with anti-HA antibody (Texas Red–streptavidin–biotin secondary) and hTS7.4 antiserum (FITC-labeled secondary antibody). The same field was viewed under red fluorescence (C), green fluorescence (D), or phase-contrast (E) (magnification x200). (F–I) Immunohistochemical analysis with hTS7.4 using biotinylated secondary/peroxidase–avidin/DAB on 48-hr postconfluent human fibroblasts that were undisturbed (F,H) or wounded to disrupt confluency (G,I) (magnification x100 for F and G and x400 for H and I).

hTS7.4 was able to distinguish the higher level of TS in proliferating primary human fibroblasts compared to the very low levels in nonproliferating, confluent fibroblasts. Immunohistochemistry was carried out on a monolayer of 48-hr postconfluent fibroblasts that had been scratched to disrupt confluency and to permit cells in the region of the wound to begin cycling (Figure 4F–4I). Cells in the untouched, confluent area of the monolayer showed very little staining (Figure 4F and Figure 4H), whereas there was relatively high cytoplasmic staining of cells near the wound that had been stimulated to enter the cell cycle (Figure 4G and Figure 4I). This finding is consistent with the Western blot showing very low TS levels in confluent cells compared to dividing cells (Figure 3A).

Immunoprecipitation of [35S]-TS from HeLa Cell Extracts
Antiserum hTS8.3 was tested for its ability to immunoprecipitate native TS from [35S]-methionine-labeled HeLa cell extracts. As shown in Figure 5, a clear 36-kD band was seen when hTS8.3 was used (Figure 5, Lane 3), whereas none was seen when preimmune serum was used (Figure 5, lane 2). The total HeLa cell extract (Figure 5, lane 1) showed no distinct band of this size because the amount of [35S]-methionine incorporated into TS represented only a very small fraction of the total. Most of the background [35S]-methionine-labeled proteins seen in Figure 5, Lanes 2 and 3, was due to nonspecific binding to the protein A–Sepharose beads.



View larger version (74K):
[in this window]
[in a new window]
 
Figure 5. Immunoprecipitation of [35S]-hTS from HeLa cell extracts with hTS8.3 antiserum. Autoradiograph of [35S]-methionine-labeled HeLa proteins before (Lane 1) and after immunoprecipitation with either preimmune serum (Lane 2) or hTS8.3 antiserum (Lane 3). An equal amount of radioactivity was loaded per lane.

Immunohistochemistry of Paraffin-embedded Tissue Samples
An application of hTS7.4 will be the assessment of TS levels in human tumor samples. To determine the utility of the antiserum for this purpose, clinical samples from the Ottawa Colorectal Tumor Bank were examined immunohistochemically. An example of a colorectal cancer specimen that showed intense staining with hTS7.4 (Figure 6A and Figure 6B) with faint or no staining with hTS7.4p (Figure 6D and Figure 6E) is presented. Normal colon mucosa (Figure 6C) showed weak staining with hTS7.4 and faint staining with hTS7.4p (Figure 6F). Other cases of colorectal cancer showed intermediate levels of staining (not shown).



View larger version (144K):
[in this window]
[in a new window]
 
Figure 6. Immunohistochemical analysis of human malignant (A,B,D,E) and normal (C,F) colon tissues with hTS7.4 (A–C) or hTS7.4p (D–F) antiserum.

As another application of hTS7.4 antiserum, paraffin-embedded human tonsil tissue sections were stained for TS (Figure 7). B-lymphocytes present in the germinal centers of tonsil tissues are known to be proliferating (Siegel 1979 Down). These cells stained positively with 1:150 diluted hTS7.4 antiserum (Figure 7A). A monoclonal antibody to TS (TS106) has recently become commercially available. To compare the two directly, a serial section was stained with TS106. At the supplier's recommended dilution for TS106 (1:50 to 1:100 of 1 mg/ml), TS was not detected. At a dilution of 1:20, staining by TS106 (Figure 7B) was similar to hTS7.4.



View larger version (83K):
[in this window]
[in a new window]
 
Figure 7. Comparison of polyclonal antibody hTS7.4 (A) and monoclonal antibody TS106 (B) for immunohistochemical staining of TS in human tonsil tissue. Details as described in Materials and Methods.


*   Discussion
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

TS has been investigated as a molecular marker in colorectal and other cancers. Although measurement of TS by [3H]-FdUMP binding, enzyme activity and mRNA levels has been employed for this purpose, these techniques do not lend themselves to the use of fixed tissues, the most readily available source of clinical samples. Immunohistochemical techniques have the advantages that they can be applied to a large number of archival samples and also provide a better measure of the localization of TS within tumors. Among the best-characterized and most widely used anti-TS antibodies for the purpose of examining clinical samples is mouse monoclonal antibody TS106 (Johnston et al. 1991 Down; Behan et al. 1998 Down). Monoclonal antibodies can have the advantage of recognizing a single epitope (Behan et al. 1998 Down), but this can be a disadvantage when different forms of a fixed or denatured protein may exist in cells fixed by different techniques. It was the objective of the present study to generate and characterize a polyclonal antiserum that was both highly specific for TS but at the same time could also recognize a broad range of epitopes.

The immunogen used was highly purified, enzymatically active recombinant human TS, containing an affinity tag of six histidine residues at its N-terminus. Highest-titer antisera were obtained in the two rabbits immunized by IM injections with Freund's adjuvant. A novel aspect of the immunizing strategy was the use of partially hydrolyzed His6-hTS. This was intended initially to solubilize the denatured, insoluble recombinant hTS, but it may also have had the effect of increasing the number of TS epitopes. Signal was detected by ELISA at 1:100,000 and by Western blotting of HeLa cell extracts at 1:10,000. Although the expected 36-kD TS band was seen on the Western blot, other bands were also detected. To obtain an antiserum with as low a nonspecific background as possible, the following strategy was employed. Rabbit #7 was maintained for 8 months to allow anti-hTS titers to drop and was then boosted with a small amount of very highly purified TS. The resultant antiserum, hTS7.4, was sufficiently specific (as determined by Western blotting of HeLa cell extracts) that no additional purification of the antiserum was needed.

Our data provide strong evidence for the specificity of hTS7.4 towards hTS. The immunogen, hTS, was shown to have TS activity. The signal on Western blots of HeLa extracts was shown to be hTS, because it was absent when blots were probed with hTS7.4p, an antiserum that had been preadsorbed with hTS immobilized on a column, but was present using hTS7.4 antiserum that had been preadsorbed with an unrelated protein. The 36-kD signal was further confirmed to be hTS in HeLa cells treated with FUdR, a drug that is converted into FdUMP and makes a stable ternary complex with TS and CH2THF. Western blots from these cells with hTS7.4 showed two distinct bands, one representing unbound hTS at 36-kD and the other the ternary complex, migrating slightly more slowly (Johnston et al. 1991 Down, Johnston et al. 1992 Down). The His6 tag, as part of an unrelated protein, was not detected by hTS7.4. The 36-kD band was detected in growing human cells by Western blotting but not in nondividing confluent fibroblasts or neutrophils. Because TS is a highly conserved protein, it was not unexpected that hTS7.4 would crossreact with TS from other species, including mouse, rat, and monkey.

The utility of hTS7.4 antiserum for immunohistochemistry was demonstrated using fixed cultured cells. By immunofluorescence, cytoplasmic staining was observed in HeLa cells and in COS-1 cells transiently overexpressing recombinant hTS. By immunohistochemistry, hTS7.4 stained rapidly proliferating primary human fibroblasts, whereas the staining was much lower in confluent fibroblasts. Both fluorescent and peroxidase staining was observed to be cytoplasmic.

We are aware of only one earlier report of a similar extensive characterization of a polyclonal antibody to TS (Okabe et al. 1997 Down). hTS7.4 appears to be superior to their antibody in several respects. Affinity purification was needed by them to obtain a usable antibody. Western blots of various human cancer cells showed many secondary bands. No evidence of application to human tumor specimens was presented.

hTS7.4 appears to be useful for the study of human colorectal cancer specimens (Jonker et al. unpublished observations). One case with very high levels of TS staining is shown in Figure 6. Normal mucosa had lower levels, and there was little or no staining in either case with hTS7.4 that was blocked by preadsorption to a hTS-containing matrix. Specimens taken from different cases demonstrate a wide range of staining (Jonker et al. unpublished observations), as observed by other workers (Johnston et al. 1994 Down; Edler et al. 1997 Down; Findlay et al. 1997 Down; Yamachika et al. 1998 Down). A comparison of hTS7.4 antiserum with commercially available MAb TS106 suggests a similar pattern of staining in tonsil tissue. We conclude that hTS7.4 will be a useful tool for the study of TS in surgically removed specimens. hTS7.4 will soon be available commercially from Rockland Immunochemicals.

Our results suggest that hTS7.4 may have application as a marker for cell proliferation. Proliferating human skin fibroblasts in culture stained for TS, whereas nonproliferating (confluent) cells did not. Similarly, B-lymphocytes in the tonsil tissue germinal center, known to be a proliferating cell compartment (Siegel 1979 Down), stained positively with hTS7.4. Biochemical evidence indicates that TS in normal human fibroblasts is very low in noncycling (G0) cells and high in cycling cells (Ayusawa et al. 1986 Down). Similarly, TS protein (measured by a ligand binding assay) in mammary epithelial cells was very low in noncycling cells and high in cycling cells, peaking in the S-phase (Keyomarsi et al. 1993 Down). Taken together, these findings strongly suggest that TS will be a useful immunohistochemical marker of cell proliferation.


*   Acknowledgments

Supported by the Medical Oncology Fund (General Division), the Foundation of the Ottawa Regional Cancer Centre, and Zeneca Pharma. ASH is a recipient of a Doctoral Research Award from the Medical Research Council of Canada. HCB is a Senior Career Scientist of Cancer Care Ontario.

We thank Joelle Levac-Caron for first demonstrating the usefulness of DAKO polymer to avoid the high backgrounds seen using avidin–peroxidase detection system in colon tissues, Louise Kobylinski and Dr Jagdeep K. Sandhu for carrying out immunohistochemistical analysis of fixed human tissues, and Helen Tai for providing His6-chromodomain protein.

Received for publication April 2, 1999; accepted July 20, 1999.


*   Literature Cited
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Adams AT, Auersperg N (1985) A cell line, ROSE 199, derived from normal rat ovarian surface epithelium. Exp Cell Biol 53:181-188[Medline]

Ayusawa D, Shimizu K, Koyama H, Kaneda S, Takeishi K, Seno T (1986) Cell-cycle-directed regulation of thymidylate synthase messenger RNA in human diploid fibroblasts stimulated to proliferate. J Mol Biol 190:559-567[Medline]

Behan KA, Johnston PG, Allegra CJ (1998) Epitope mapping of a series of human thymidylate synthase monoclonal antibodies. Cancer Res 58:2606-2611[Abstract/Free Full Text]

Calvert AH, Jones TR, Dady PJ, Grzelakowska-Sztabert B, Paine RM, Taylor GA, Harrap KR (1980) Quinazoline antifolates with dual biochemical loci of action. Biochemical and biological studies directed towards overcoming methotrexate resistance. Eur J Cancer 16:713-722

Cowling RT, Birnboim HC (1994) Incorporation of [32]orthophosphate into inorganic polyphosphates by human granulocytes and other cell types. J Biol Chem 269:9480-9485[Abstract/Free Full Text]

Cowling RT, Birnboim HC (1998) Characterization of the protein encoded by human testis-enhanced gene transcript (TEGT). Mol Membr Biol 15:177-187[Medline]

Davisson VJ, Sirawaraporn W, Santi DV (1989) Expression of human thymidylate synthase in Escherichia coli. J Biol Chem 264:9145-9148[Abstract/Free Full Text]

De Vouge MW, Yamazaki A, Bennett SAL, Chen J-H, Shwed PS, Couture C, Birnboim HC (1994) Immunoselection of GRP94/endoplasmin from a KNRK cell-specific lambda gt11 library using antibodies directed against a putative heparanase amino terminal peptide. Int J Cancer 56:286-294[Medline]

Drake JC, Allegra CJ, Johnston PG (1993) Immunological quantitation of thymidylate synthase-FdUMP-5,10-methylenetetrahydrofolate ternary complex with the monoclonal antibody TS 106. Anticancer Drugs 4:431-435[Medline]

Edler D, Blomgren H, Allegra CJ, Johnston PG, Lagerstedt U, Magnusson I, Ragnhammar P (1997) Immunohistochemical determination of thymidylate synthase in colorectal cancer—methodological studies. Eur J Cancer 33:2278-2281

Findlay MP, Cunningham D, Morgan G, Clinton S, Hardcastle A, Aherne GW (1997) Lack of correlation between thymidylate synthase levels in primary colorectal tumours and subsequent response to chemotherapy. Br J Cancer 75:903-909[Medline]

Gorlick R, Metzger R, Danenberg KD, Salonga D, Miles JS, Longo GS, Fu J, Banerjee D, Klimstra D, Jhanwar S, Danenberg PV, Kemeny N, Bertino JR (1998) Higher levels of thymidylate synthase gene expression are observed in pulmonary as compared with hepatic metastases of colorectal adenocarcinoma. J Clin Oncol 16:1465-1469[Abstract/Free Full Text]

Johnston PG, Drake JC, Trepel J, Allegra CJ (1992) Immunological quantitation of thymidylate synthase using the monoclonal antibody TS 106 in 5-fluorouracil-sensitive and -resistant human cancer cell lines. Cancer Res 52:4306-4312[Abstract/Free Full Text]

Johnston PG, Fisher ER, Rockette HE, Fisher B, Wolmark N, Drake JC, Chabner BA, Allegra CJ (1994) The role of thymidylate synthase expression in prognosis and outcome of adjuvant chemotherapy in patients with rectal cancer. J Clin Oncol 12:2640-2647[Abstract/Free Full Text]

Johnston PG, Lenz HZ, Leichman CG, Danenberg KD, Allegra CJ, Danenberg PV, Leichman L, Lenz HJ (1995) Thymidylate synthase gene and protein expression correlate and are associated with response to 5-fluorouracil in human colorectal and gastric tumors. Cancer Res 55:1407-1412[Abstract/Free Full Text]

Johnston PG, Liang CM, Henry S, Chabner BA, Allegra CJ (1991) Production and characterization of monoclonal antibodies that localize human thymidylate synthase in the cytoplasm of human cells and tissue. Cancer Res 51:6668-6676[Abstract/Free Full Text]

Keyomarsi K, Samet J, Molnar G, Pardee AB (1993) The thymidylate synthase inhibitor, ICI D1694, overcomes translational detainment of the enzyme. J Biol Chem 268:15142-15149[Abstract/Free Full Text]

Kuniyasu T, Nakamura T, Tabuchi Y, Kuroda Y (1998) Immunohistochemical evaluation of thymidylate synthase in gastric carcinoma using a new polyclonal antibody: the clinical role of thymidylate synthase as a prognostic indicator and its therapeutic usefulness. Cancer 83:1300-1306[Medline]

Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]

Leichman CG, Lenz HJ, Leichman L, Danenberg K, Baranda J, Groshen S, Boswell W, Metzger R, Tan M, Danenberg PV (1997) Quantitation of intratumoral thymidylate synthase expression predicts for disseminated colorectal cancer response and resistance to protracted-infusion fluorouracil and weekly leucovorin. J Clin Oncol 15:3223-3229[Abstract]

Okabe H, Tsujimoto H, Fukushima M (1997) Preparation of the antibodies against recombinant human thymidylate synthase for the detection of its intratumoural levels and the application to sensitivity-study of 5-fluorouracil. Oncol Rep 4:685-690

Pestalozzi BC, Peterson HF, Gelber RD, Goldhirsch A, Gusterson BA, Trihia H, Lindtner J, Cortes–Funes H, Simmoncini E, Byrne MJ, Golouh R, Rudenstam CM, Castiglione–Gertsch M, Allegra CJ, Johnston PG (1997) Prognostic importance of thymidylate synthase expression in early breast cancer. J Clin Oncol 15:1923-1931[Abstract/Free Full Text]

Reyes P, Heidelberger C (1965) Mammalian thymidylate synthetase: its mechanism of action and inhibition by fluorinated nucleotides. Mol Pharmacol 1:14-30[Abstract/Free Full Text]

Rodriguez–Bigas MA, Petrelli NJ (1993) Biochemical modulation of fluoropyrimidines and other drugs. In Wanebo HJ, ed. Colorectal Cancer. St Louis, CV Mosby, 509-522

Rustum YM, Harstrick A, Cao S, Vanhoefer U, Yin MB, Wilke H, Seeber S (1997) Thymidylate synthase inhibitors in cancer therapy: direct and indirect inhibitors. J Clin Oncol 15:389-400[Abstract/Free Full Text]

Sanguedolce R, Dardanoni G, Grassadonia A, Vultaggio G, Russo A, Bazan V, Rausa L (1995) Thymidylate synthase level in operable colorectal carcinoma: a prospective study of 62 untreated patients. Anticancer Res 15:1800-1801

Sanguedolce R, Vultaggio G, Sanguedolce F, Modica G, Li VF, Diana G, Guereio G, Bellanca L, Rausa L (1998) The role of thymidylate synthase levels in the prognosis and the treatment of patients with colorectal cancer. Anticancer Res 18:1515-1520[Medline]

Siegel G (1979) Evidence for selective proliferation and histological localisation of B lymphocytes in the human tonsil. ORL J Otorhinolaryngol Relat Spec 41:147-157[Medline]

Suzuki M, Ohwada M, Tamada T, Tsuru S (1994) Thymidylate synthase activity as a prognostic factor in ovarian cancer. Oncology 51:334-338[Medline]

Udenfriend S, Stein S, Bohlen P, Dairman W, Leimgruber W, Weigele M (1972) Fluorescamine: a reagent for assay of amino acids, peptides, proteins, and primary amines in the picomole range. Science 178:871-872[Abstract/Free Full Text]

Wilkinson D, Sandhu JK, Breneman JW, Tucker JD, Birnboim HC (1995) Hprt mutants in a transplantable murine tumour arise more frequently in vivo than in vitro.. Br J Cancer 72:1234-1240[Medline]

Yamachika T, Nakanishi H, Inada K, Tsukamoto T, Kato T, Fukushima M, Inoue M, Tatematsu M (1998) A new prognostic factor for colorectal carcinoma, thymidylate synthase, and its therapeutic significance. Cancer 82:70-77[Medline]

Yeh KH, Shun CT, Chen CL, Lin JT, Lee WJ, Lee PH, Chen YC, Cheng AL (1998) High expression of thymidylate synthase is associated with the drug resistance of gastric carcinoma to high dose 5-fluorouracil-based systemic chemotherapy. Cancer 82:1626-1631[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
S. Bissoon-Haqqani, T. Moyana, D. Jonker, J. A. Maroun, and H. C. Birnboim
Nuclear Expression of Thymidylate Synthase in Colorectal Cancer Cell Lines and Clinical Samples
J. Histochem. Cytochem., January 1, 2006; 54(1): 19 - 29.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. S. Haqqani, J. F. Kelly, and H. C. Birnboim
Selective Nitration of Histone Tyrosine Residues in Vivo in Mutatect Tumors
J. Biol. Chem., January 25, 2002; 277(5): 3614 - 3621.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haqqani, A. S.
Right arrow Articles by Birnboim, H. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haqqani, A. S.
Right arrow Articles by Birnboim, H. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact