Journal of Histochemistry and Cytochemistry
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wolf, W. C.
Right arrow Articles by Chao, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolf, W. C.
Right arrow Articles by Chao, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Histochemistry and Cytochemistry, Vol. 47, 221-228, February 1999, Copyright © 1999, The Histochemical Society, Inc.


ARTICLE

Localization and Expression of Tissue Kallikrein and Kallistatin in Human Blood Vessels

William C. Wolfa, Russell A. Harleyb, Dan Sluceb, Lee Chaoa, and Julie Chaoa
a Departments of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, South Carolina
b Pathology and Laboratory Medicine, Medical University of South Carolina, Charleston, South Carolina

Correspondence to: Julie Chao, Dept. of Biochemistry and Molecular Biology, Medical U. of South Carolina, 171 Ashley Ave., Charleston, SC 29425.


*   Summary
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Tissue kallikrein releases kinins by specific proteolysis, an activity inhibited by kallistatin. In this study, kallikrein and kallistatin were localized to endothelial and smooth muscle cells of large, medium, and small normal blood vessels by immunohistochemical techniques. Immunostaining for both proteins was strong in the endothelium of all sizes of blood vessels and was more intense in medial smooth muscle cells of small and medium-sized blood vessels than in elastic arteries. The sites of synthesis by endothelial and smooth muscle cells were demonstrated in normal blood vessels of all sizes by in situ hybridization histochemistry. Kallikrein and kallistatin levels were measured by immunoassays in homogenates of human aorta, vena cava, and iliac artery and vein. Tissue kallikrein and kallistatin transcripts were identified in human blood vessels by RT-PCR followed by Southern blot analysis with specific oligonucleotide probes. The results demonstrated the expression and co-localization of tissue kallikrein and kallistatin in human vessels and suggest a potential role of kallistatin in regulating tissue kallikrein in blood vessels. (J Histochem Cytochem 47:221–228, 1999)

Key Words: tissue kallikrein, kallistatin, endothelial cell, smooth muscle cell, localization


*   Introduction
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Tissue kallikrein is a serine proteinase that cleaves kininogen to release the kinin peptides bradykinin and lys-bradykinin. Kinins are locally active hormones that participate in the regulation of local blood flow, decrease peripheral vascular resistance, and increase vascular permeability (reviewed in Bhoola et al. 1992 Down). By binding to endothelial bradykinin B2 receptors, kinins act as potent vasodilators by stimulating the release of prostacyclin, nitric oxide and endothelium-derived hyperpolarizing factor (reviewing in Hornig and Drexler 1997 Down). Bradykinin B2 receptor gene knockout in mice demonstrated that a normally functioning B2 receptor is essential for maintaining cardiovascular homeostasis (Madeddu et al. 1997 Down). Kinins have also been shown to affect vascular cell growth (Ziche et al. 1993 Down; Dixon and Dennis 1997 Down). Angiotensin-converting enzyme (ACE), or kininase II, is a kinin degrading enzyme. Evidence indicates that the reduction of blood pressure and the cardiovascular protective effects of ACE inhibition are, at least in part, due to an increase in kinin levels (Wiemer et al. 1994 Down; Hornig et al. 1997 Down). Because the kininogen substrate is abundant in plasma and tissues (Bhoola et al. 1992 Down; Figueroa et al. 1992 Down), the expression and availability of tissue kallikrein are the rate-limiting factors in kinin production.

Human kallistatin is a novel member of the serine proteinase inhibitor (serpin) superfamily which was purified, cloned, and characterized in our laboratory (reviewed in Chao and Chao 1995 Down). Kallistatin rapidly binds to tissue kallikrein and inhibits its enzymatic activity in vitro (Zhou et al. 1992 Down), and it profoundly affects the clearance rate of kallikrein in vivo (Xiong et al. 1992 Down). These studies suggest that kallistatin is a potential physiological regulator of tissue kallikrein. This hypothesis has been further supported by co-localization at the cellular level of kallistatin and tissue kallikrein mRNAs in the human kidney, adrenal gland, and eye (Chen et al. 1995 Down; Ma et al. 1996 Down; Wang et al. 1996 Down). However, kallistatin is a multifunctional protein that has demonstrated vasodilatory effects independent of an interaction with the kallikrein–kinin system (Chao et al. 1997 Down). Kallistatin caused an in vivo hypotensive response in a dose-dependent manner, vasodilatation in isolated perfused kidney, and also relaxed isolated aortic rings. Specific binding sites were demonstrated with aorta membrane preparations, indicating that kallistatin may have a direct interaction with smooth muscle cell membrane proteins, resulting in relaxation. Somatic delivery of the kallistatin gene to spontaneously hypertensive rats (SHR) resulted in a significant delay in the elevation of blood pressure for 4 weeks (Chen et al. 1997a Down). Our localizations of kallikrein and kallistatin in blood vessels provide a further insight into their potential roles in vascular homeostasis.


*   Materials and Methods
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Tissue Samples for Immunohistochemistry and In Situ Hybridization
Four-µm sections were cut from formalin-fixed, paraffin-embedded archival surgical specimens. Vessels were examined from a number of anatomic sites, including the pancreas, small intestine, salivary gland, kidney, adrenal glands, aorta, splenic and renal artery and vein, iliac artery, spleen, lymph node, lung, and loose connective tissue, obtained during surgery for metastatic disease, trauma, or reconstruction.

Antibodies for Immunohistochemistry
Details of the isolation and characterization of the monoclonal antibody (MAb) G4C10, specific for human kallistatin, has been published previously (Chao et al. 1996 Down). By Western blot analysis, G4C10 was unreactive towards other serum proteins and other serpins including {alpha}1-anti-trypsin, {alpha}1-anti-chymotrypsin, and rat kallikrein binding protein. The specificity of the rabbit antiserum against human tissue kallikrein has been previously published (Proud and Vio 1993 Down). To identify endothelial and smooth muscle cells in vessels evaluated for tissue kallikrein and kallistatin, commercially available MAbs to von Willebrand factor and {alpha}-smooth muscle actin (Dako; Carpinteria, CA), respectively, were used.

Immunohistochemistry
Immunohistochemistry was performed using the TechMate 500 robotic workstation (Ventana; Tucson, AZ) for automated histochemistry. The Steam Heat Induced Epitope Retrieval and MIP (a standard immunoperoxidase procedure using avidin–biotin–peroxidase complex) protocols and ChemMate reagents were used as directed by the manufacturer (Ventana). Color development was performed with diaminobenzidine tetrahydrochloride provided with the ChemMate reagents. For kallistatin immunohistochemistry, MAb G4C10 was used at dilutions of 1:400–1:800. Equally diluted mouse control ascites fluid was used as negative control. Rabbit anti-human tissue kallikrein antiserum was used at dilutions of 1:1200 and 1:2000 to detect kallikrein, and equal dilutions of normal rabbit serum served as negative controls. In control experiments, preabsorption of tissue kallikrein antiserum with purified human tissue kallikrein eliminated immunoreactivity.

In Situ Hybridization Histochemistry
In situ hybridizations specific for kallistatin and tissue kallikrein were performed as previously reported (Chen et al. 1995 Down; Ma et al. 1996 Down; Wang et al. 1996 Down). A 186-BP human tissue kallikrein cDNA fragment and a 153-BP human kallistatin cDNA fragment were used to generate digoxygenin–UTP-labeled anti-sense and sense riboprobes. Anti-sense riboprobes specific for either tissue kallikrein or kallistatin transcript were used to identify the respective mRNA. Control sections were incubated with a labeled sense riboprobe. Additional controls were pretreated with RNase A before incubation with an anti-sense riboprobe. Liver sections were used as a positive tissue control for kallistatin in situ hybridization. Pancreas sections served as positive control for tissue kallikrein.

Collection of Vessels for ELISA and RT-PCR
Blood vessels removed at autopsy 6–12 hr after death were obtained from the Pathology Department of the Medical University of South Carolina. Total RNA was extracted with Trizol reagent according to the manufacturer's directions (Life Technologies; Rockville, MD). Blood vessels for ELISA were rinsed, minced, and homogenized in PBS, pH 7.4, at 4C. Homogenates were initially centrifuged at 600 x g for 20 min. Supernatants were incubated for 30 min at 4C in 0.5% sodium deoxycholate and centrifuged at 10,000 x g for 30 min, and the pellets discarded. Protein concentration was determined by the Lowry method (Lowry et al. 1951 Down) with bovine serum albumin as the standard.

Tissue Kallikrein and Kallistatin Immunoassays
ELISAs were performed using specific polyclonal antibodies, as previously described, against either tissue kallikrein (Chen et al. 1995 Down) or human kallistatin (Chao et al. 1996 Down).

RT-PCR/Southern Blot Analysis for Human Tissue Kallikrein and Kallistatin mRNAs
Reverse transcription (RT) was performed with Moloney murine leukemia virus reverse transcriptase (Life Technologies), 2 µg of total RNA, and 100 nmol random hexamers (Life Technologies) according to the manufacturer's protocol. Polymerase chain reaction (PCR) was performed on 1 µl of the first-strand cDNA in a 50-µl reaction mixture using primers that were designed from unique sequences of human tissue kallikrein (5' primer, AACACAGCCCA-GTTTGT; 3' primer, CTTCAC-ATAAGACAGCAC), human kallistatin (5' primer, CTATGGTTTCGTGGGTC; 3' primer, GGCACAATCCAGCTTATC), or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (5' primer, ATCCCATCACCATCTTCCAG; 3' primer, CCTGCTTCACCA-CCTTCTTG). All sets of primers were designed to cross intron–exon boundaries. For tissue kallikrein and kallistatin amplifications of 30 PCR cycles (94C, 1 min; 55C, 1 min; 72C, 1 min) were performed in a thermal cycler, whereas for GAPDH 25 cycles (94C, 1 min; 60C, 1 min; 72C, 1 min) were performed. The PCR product was subjected to Southern blot analysis with a nested oligonucleotide probe specific to the respective gene (tissue kallikrein, GACCTCAAATCCCTGCC; kallistatin, CTCTGGAGTCAGAACCTC; GAPDH, GACCACAGTCCATGCCAT). Hybridization was carried out as previously described (Chao et al. 1996 Down).


*   Results
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Cellular Localization and Expression of Tissue Kallikrein and Kallistatin in Normal Vessels
At low power, the immunohistochemical reactivity for both tissue kallikrein (Figure 1A) and kallistatin (Figure 1D) was more intense in the endothelium and the vasa vasorum than in the media. Overall, the tunica media was more intensely stained for kallistatin than for tissue kallikrein. At higher power, distinct cytoplasmic reactivity was discernible in aortic vascular smooth muscle cells and endothelial cells, and there were increased numbers of medial smooth muscle cells positive for kallistatin (Figure 1E) compared to kallikrein (Figure 1B). Immunohistochemistry was done with anti-von Willebrand factor antibody to identify endothelial cells (Figure 1C). The identity of vascular smooth muscle cells was ascertained by immunostaining for {alpha}-smooth muscle actin (Figure 1F). No reactivity was observed when normal rabbit serum was used as a negative control for the rabbit antiserum specific for human tissue kallikrein (not shown) or when anti-kallikrein antiserum was preabsorbed with purified kallikrein (not shown). In addition, reactivity was absent when mouse ascites fluid was used as negative control for the MAb specific for human kallistatin (not shown).



View larger version (91K):
[in this window]
[in a new window]
 
Figure 1. Immunohistochemical localization of kallistatin and tissue kallikrein in human aorta. (A,B) Results using a polyclonal antiserum specific for human tissue kallikrein. (D,E) Results using a monoclonal antibody specific for human kallistatin. At low power (A,D) intense reactivity for kallikrein and kallistatin delineates the endothelium (black arrow) and vasa vasorum (white arrow). Bars = 75 µm. At higher power (B,E), staining for both proteins can be seen in smooth muscle cells of the tunica media. (C) Immunohistochemistry of aorta with an MAb specific for von Willebrand factor. Endothelial cells (black arrow) are intensely reactive. (F) Immunohistochemistry of aorta with an MAb specific for {alpha}-smooth muscle actin. Sections are not counterstained. Bars = 25 µm.

Figure 2 illustrates the similar immunohistochemical reactivity for tissue kallikrein (top row) and kallistatin (middle row) that was typical in normal medium-sized (muscular) and small vessels. In comparison to the aorta (Figure 1), smooth muscle cells in the tunica media of medium-sized vessels and arterioles were more reactive for both proteins. The higher magnification for medium vessels showed nuclei of smooth muscle cells that were often outlined by the intense cytoplasmic staining for both tissue kallikrein (Figure 2A and Figure 2B) and kallistatin (Figure 2D and Figure 2E). As in the aorta, there was strong cytoplasmic reactivity for tissue kallikrein and kallistatin in endothelial cells of medium and small arteries and veins. Reactivity was absent when normal rabbit serum was used as a negative control (Figure 2G–I) for the rabbit antiserum specific for human tissue kallikrein or when anti-kallikrein antibody was preabsorbed with purified kallikrein (not shown). A similar absence of reactivity was seen for control mouse ascites fluid (not shown), used as negative control for the MAb specific for human kallistatin.



View larger version (107K):
[in this window]
[in a new window]
 
Figure 2. Immunohistochemical localization of tissue kallikrein and kallistatin in normal medium-sized (muscular) and small vessels. Endothelial and smooth muscle cells of medium (first two columns) and small (third column) show strong cytoplasmic reactivity for both tissue kallikrein (top row) and kallistatin (middle row). C and F show adjacent sections that contain a small muscular artery (SMA), arteriole (Ar), and venule (Ve). G, H, and I show the absence of reactivity when normal rabbit serum is used as negative control. Sections are not counterstained. Bars: A, B, D, E, G, H = 25 µm; C, F, I = 75 µm.

Figure 3 shows the in situ localization of tissue kallikrein and kallistatin mRNA revealed by using specific digoxygenin-labeled anti-sense riboprobes. Reactivity indicated that both tissue kallikrein (Figure 3A and Figure 3B) and kallistatin (Figure 3C and Figure 3D) mRNAs are synthesized by endothelial and smooth muscle cells in the aorta (Figure 3A and Figure 3C) and small vessels (Figure 3B and Figure 3D). Medium vessels (not shown) displayed positive staining in endothelial and smooth muscle cells similar to the staining seen in aorta and small muscular artery (SMA) in this figure. Reactivity was absent when a sense riboprobe was used for hybridization for tissue kallikrein (Figure 3E and Figure 3F) or kallistatin (not shown). In addition, no staining was seen when sections were treated with RNase A before hybridization with the respective anti-sense probes (not shown). These results demonstrate the specificity of labeled anti-sense probes for kallistatin or kallikrein transcripts.



View larger version (136K):
[in this window]
[in a new window]
 
Figure 3. In situ hybridization histochemical localization of tissue kallikrein and kallistatin in normal vessels. Positive reactivity is seen in endothelial (black arrows) and smooth muscle cells when anti-sense probes specific for tissue kallikrein (top row) or kallistatin (middle row) were used for hybridization. E and F show the absence of reactivity when tissue kallikrein sense riboprobe was used as a negative control. Abbreviations as in Figure 2. Bars: A, C, E = 25 µ; B, D, F = 50 µm.

Immunoreactive Tissue Kallikrein and Kallistatin Levels in Human Blood Vessels
Table 1 shows the levels of immunoreactive human tissue kallikrein and kallistatin in aorta, vena cava, and iliac (muscular) artery and vein measured by ELISA. Human tissue kallikrein levels are greater in the muscular (iliac) vessels than in large, elastic (aorta and vena cava) vessels. In all vessels examined, kallistatin is present in excess of tissue kallikrein. Figure 4 shows a typical curve for the tissue kallikrein standard and curves for immunoreactive kallikrein in serially diluted homogenates of aorta, vena cava, and iliac artery or vein. Dose-dependent curves of sample homogenates are parallel with the standard curve, indicating their immunological identity. Figure 5 shows curves for the kallistatin standard and for immunoreactive kallistatin in the aorta, vena cava, and iliac artery and vein. Lines for the serial dilutions of these samples are also parallel to the standard displacement curve, indicating immunological identity to purified kallistatin used as standard.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. ELISA of human tissue kallikrein. The standard curve of purified human tissue kallikrein ranges from 0.2 to 6.4 ng/ml. Homogenates of human aorta, vena cava, and iliac artery and vein were serially diluted and the results graphed to assess parallelism to the standard curve.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. ELISA of human kallistatin. The standard curve of purified kallistatin ranges from 0.4 to 25 ng/ml. Homogenates of human aorta, vena cava, and iliac artery and vein were serially diluted and results graphed to assess parallelism to the kallistatin standard.


 
View this table:
[in this window]
[in a new window]
 
Table 1. Levels of tissue kallikrein and kallistatin in human aorta, vena cava, iliac artery, and iliac veina

Identification of Tissue Kallikrein and Kallistatin Transcripts in Human Vessels by RT-PCR/Southern Blot Analysis
Figure 6 shows the identification of tissue kallikrein and kallistatin mRNAs in human vessels (aorta, vena cava, iliac artery and vein) as determined by specific RT-PCR amplification and verified by Southern blot analysis. The band migrations were consistent with the expected product sizes and were the same as amplified tissue kallikrein or kallistatin cDNA controls (not shown), indicating that the PCR products were not amplified from genomic DNA. Integrity of the RNAs used in the RT-PCR reactions was evaluated by RT-PCR/Southern analysis for glyceraldehyde-3-phosphate dehydrogenase, a constitutively expressed gene. These results suggest that tissue kallikrein and kallistatin are synthesized locally in vessels and support the results of our in situ hybridization.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 6. Identification of tissue kallikrein and kallistatin transcripts in human vessels by RT-PCR and Southern blot analysis. Total RNA from each tissue was reverse-transcribed and amplified by PCR using gene-specific primers. Products were probed (Southern analysis) by nested primers specific for tissue kallikrein (top row), kallistatin (middle row), and glyceraldehyde-3-phosphate dehydrogenase (bottom row).


*   Discussion
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

This study is the first to demonstrate both the immunohistochemical localization and the in situ synthesis of tissue kallikrein and kallistatin in endothelial and vascular smooth muscle cells of human large, medium and small blood vessels. Our immunohistochemical localization of tissue kallikrein in human vessels is consistent with a recent localization by Raidoo and co-workers (1997), except that they did not detect kallikrein in medial smooth muscle cells of large elastic vessels. The discrepancy may be attributed to the fact that their samples were obtained from autopsy and may have undergone some autolysis, rendering medial kallikrein undetectable. Tissue kallikrein and kallistatin are expressed in cultured endothelial cells (Wiemer et al. 1994 Down; Chao et al. 1996 Down), and kininogenase, kininogen, and kininases have been detected in cultured rat vascular smooth muscle cells (Oza et al. 1990 Down). In rat vessels, the presence of a tissue kallikrein-like proteinase and the synthesis of tissue kallikrein mRNA have been previously shown (Nolly et al. 1985 Down; Saed et al. 1990 Down). Collectively, these data support the notion that a local kallikrein–kinin system is an integral component of vessels that may participate in the regulation of vascular homeostasis.

The observation that tissue kallikrein appears more pronounced in human medium and small vessels is consistent with previous results revealing a similar pattern for the kininogen substrate (Figueroa et al. 1992 Down), tissue kallikrein activity (Madeddu et al. 1993 Down; Nolly et al. 1992 Down), and bradykinin receptors (Raidoo et al. 1997 Down). Physiological studies indicate the importance of the kallikrein–kinin system in regulating the vascular tone in medium and small vessels to control blood flow to tissues. For example, in humans the endothelium-mediated vasodilatation of the radial and coronary arteries (both are muscular arteries) induced by increasing blood flow was found to be kinin-dependent (Cockcroft et al. 1994 Down; Groves et al. 1995 Down; Hornig et al. 1997 Down). Pathological conditions such as arteriosclerosis induce progressive impairment of endothelium-dependent vasodilatation in these vessels and promote generation of vasoconstrictors. ACE inhibition may help restore an important kinin-mediated function to the endothelium because it has been found to induce a 10-fold potentiation of the action of kinins in the coronary circulation (Hecker et al. 1994 Down; Bossaller et al. 1992 Down).

Kinins also contribute significantly to the inflammatory response by mediating vasodilatation and increasing vascular permeability (Bhoola et al. 1992 Down). Tissue kallikrein has been localized to neutrophils (Figueroa et al. 1989 Down) and may contribute to the extravasation of neutrophils from vessels and into tissues, a process that further contributes to increased permeability and edema. It is possible that the presence of kallistatin in vessels may provide anti-inflammatory protection. Overexpression in mice of rat kallikrein-binding protein significantly increased survival during endotoxic shock (Chen et al. 1997b Down). In humans, plasma kallistatin, normally about 21 mg/liter, declined to almost a third of this level during sepsis, which implies a consumption during systemic inflammatory reactions (Chao et al. 1996 Down).

Kallistatin is a heparin-binding serpin, and its interaction with tissue kallikrein is markedly attenuated by heparin binding (Zhou et al. 1992 Down). Many heparin binding serpins also interact with and are modulated by heparan sulfates and other glycosaminoglycans found in the vascular extracellular matrix and on endothelial and smooth muscle cell surfaces (Carlson et al. 1995 Down; Shirk et al. 1996 Down). The vascular functions of kallistatin may be similarly modulated. The co-localization of kallikrein and kallistatin in blood vessels strengthens the likelihood that they may co-exist as enzyme and inhibitor there and in other tissues. The interactions of kallikrein and kallistatin with other constituents of blood vessels and the role of the kallikrein–kinin system in cardiovascular pathophysiology are subjects of ongoing investigations.


*   Acknowledgments

Supported by National Institutes of Health grants HL 44083 and HL 29397.

We wish to thank Dr Jo Ann Simson for expert technical advice and Dr Gary Richards for critical evaluation of the manuscript.

Received for publication May 28, 1998; accepted October 6, 1998.


*   Literature Cited
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Bhoola KD, Figueroa CD, Worthy K (1992) Bioregulation of kinins: kallikreins, kininogens, and kininases. Pharmocol Rev 44:1-80[Medline]

Bossaller C, Auch–Schwelk W, Grafe M, Graf K, Baumgarten C, Fleck E (1992) Effects of converting enzyme inhibition on endothelial bradykinin metabolism and endothelium-dependent vascular relaxation. Agents Actions Suppl 38:171-177

Carlson TH, Kolman MR, Piepkorn M (1995) Activation of antithrombin III isoforms by heparan sulphate glycosaminoglycans and other sulphated polysaccharides. Blood Coagul Fibrinol 6:474-480[Medline]

Chao J, Chao L (1995) Biochemistry, regulation and potential function of kallistatin. Biol Chem Hoppe Seyler 376:705-713[Medline]

Chao J, Schmaier A, Chen LM, Yang Z, Chao L (1996) Kallistatin, a novel human tissue kallikrein inhibitor: levels in body fluids, blood cells, and tissues in health and disease. J Lab Clin Med 127:612-620[Medline]

Chao JL, Stallone JN, Liang YM, Chen LM, Wang DZ, Chao L (1997) Kallistatin is a potent new vasodilator. J Clin Invest 100:11-17[Medline]

Chen LM, Chao L, Chao J (1997a) Adenovirus-mediated delivery of human kallistatin gene reduces blood pressure of spontaneously hypertensive rats. Hum Gene Ther 8:341-347[Medline]

Chen LM, Chao L, Chao J (1997b) Beneficial effects of kallikrein-binding protein in transgenic mice during endotoxic shock. Life Sci 60:1431-1435[Medline]

Chen LM, Song Q, Chao L, Chao J (1995) Cellular localization of tissue kallikrein and kallistatin mRNAs in human kidney. Kidney Int 48:690-697[Medline]

Cockcroft JR, Chowienczyk PJ, Brett SE, Bender N, Ritter JM (1994) Inhibition of bradykinin-induced vasodilation in human forearm vasculature by icatibant, a potent B2-receptor antagonist. Br J Clin Pharmacol 38:317-321[Medline]

Dixon BS, Dennis MJ (1997) Regulation of mitogenesis by kinins in arterial smooth muscle cells. Am J Physiol 42:C7-20

Figueroa CD, Gonzalez CB, Muller–Esterl W, Bhoola KD (1992) Cellular localization of human kininogens. Agents Actions Suppl 38:617-626

Figueroa CD, MacIver AG, Bhoola KD (1989) Identification of a tissue kallikrein in human polymorphonuclear leucocytes. Br J Haematol 72:321-328[Medline]

Groves P, Kurz S, Just H, Drexler H (1995) Role of endogenous bradykinin in human coronary vasomotor control. Circulation 92:3424-3430[Abstract/Free Full Text]

Hecker M, Porsti I, Bara AT, Busse R (1994) Potentiation by ACE inhibitors of the dilator response to bradykinin in the coronary microcirculation: interaction at the receptor level. Br J Pharmacol 111:238-244[Medline]

Hornig B, Drexler H (1997) Endothelial function and bradykinin in humans. Drugs 54:42-47

Hornig B, Kohler C, Drexler H (1997) Role of bradykinin in mediating vascular effects of angiotensin-converting enzyme inhibitors in humans. Circulation 95:1115-1118[Abstract/Free Full Text]

Lowry O, Rosebrough N, Farr A, Randall R (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 93:265-275

Ma JX, Song Q, Hatcher HC, Crouch RK, Chao L, Chao J (1996) Expression and cellular localization of the kallikrein-kinin system in human ocular tissues. Exp Eye Res 63:19-26[Medline]

Madeddu P, Gherli T, Bacciu PP, Maioli M, Glorioso N (1993) A kallikrein-like enzyme in human vascular tissue. Am J Hypertens 6:344-348[Medline]

Madeddu P, Varoni MV, Palomba D, Emanueli C, Demontis MP, Glorioso N, Dess–Fulgheri P, Sarzani R, Anania V (1997) Cardiovascular phenotype of a mouse strain with disruption of bradykinin B2 receptor gene. Circulation 96:3570-3578[Abstract/Free Full Text]

Nolly HL, Lama MC, Carretero OA, Scicli AG (1992) The kallikrein-kinin system in blood vessels. Agents Actions Suppl 38:1-9

Nolly HL, Scicli AG, Scicli G, Carretero OA (1985) Characterization of a kininogenase from rat vascular tissue resembling tissue kallikrein. Circ Res 56:816-821[Abstract/Free Full Text]

Oza NB, Schwartz JH, Goud HD, Levinsky NG (1990) Rat aortic smooth muscle cells in culture express kallikrein, kininogen, and bradykininase activity. J Clin Invest 85:597-600

Proud D, Vio CP (1993) Localization of immunoreactive tissue kallikrein in human trachea. Am J Respir Cell Mol Biol 8:16-19

Raidoo DM, Ramsaroop R, Naidoo S, Muller–Esterl W, Bhoola KD (1997) Kinin receptors in human vascular tissue: their role in atheromatous disease. Immunopharmacology 36:153-160[Medline]

Saed GM, Carretero OA, MacDonald RJ, Scicli AG (1990) Kallikrein messenger RNA in rat arteries and veins. Circ Res 67:510-516[Abstract/Free Full Text]

Shirk RA, Church FC, Wagner WD (1996) Arterial smooth muscle cell heparan sulfate proteoglycans accelerate thrombin inhibition by heparin cofactor II. Arterioscler Thromb Vasc Biol 16:1138-1146[Abstract/Free Full Text]

Wang DZ, Song Q, Chen LM, Chao L, Chao J (1996) Expression and cellular localization of tissue kallikrein-kinin system in human adrenal gland. Am J Physiol 271:F709-716[Abstract/Free Full Text]

Wiemer G, Scholkens BA, Linz W (1994) Endothelial protection by converting enzyme inhibitors. Cardiovasc Res 28:166-172[Free Full Text]

Xiong W, Tang CQ, Zhou GX, Chao L, Chao J (1992) In vivo catabolism of human kallikrein-binding protein and its complex with tissue kallikrein. J Lab Clin Med 119:514-521[Medline]

Zhou GX, Chao L, Chao J (1992) Kallistatin: a novel human tissue kallkrein inhibitor. Purification, characterization, and reactive center sequence. J Biol Chem 267:25873-25880[Abstract/Free Full Text]

Ziche M, Morbidelli L, Masini E, Granger H, Geppetti P, Ledda F (1993) Nitric oxide promotes DNA synthesis and cyclic GMP formation in endothelial cells from postcapillary venules. Biochem Biophys Res Commun 192:1198-1203[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
HypertensionHome page
B. Shen, M. Hagiwara, Y.-Y. Yao, L. Chao, and J. Chao
Salutary Effect of Kallistatin in Salt-Induced Renal Injury, Inflammation, and Fibrosis via Antioxidative Stress
Hypertension, May 1, 2008; 51(5): 1358 - 1365.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
Q. Luo, L. Siconolfi-Baez, P. Annamaneni, M. T. Bielawski, P. M. Novikoff, and R. H. Angeletti
Altered protein expression at early-stage rat hepatic neoplasia
Am J Physiol Gastrointest Liver Physiol, May 1, 2007; 292(5): G1272 - G1282.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
A Del Rosso, O Distler, A F Milia, C Emanueli, L Ibba-Manneschi, S Guiducci, M L Conforti, S Generini, A Pignone, S Gay, et al.
Increased circulating levels of tissue kallikrein in systemic sclerosis correlate with microvascular involvement
Ann Rheum Dis, March 1, 2005; 64(3): 382 - 387.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Bossi, F. Fischetti, V. Pellis, R. Bulla, E. Ferrero, T. E. Mollnes, D. Regoli, and F. Tedesco
Platelet-Activating Factor and Kinin-Dependent Vascular Leakage as a Novel Functional Activity of the Soluble Terminal Complement Complex
J. Immunol., December 1, 2004; 173(11): 6921 - 6927.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Q. Miao, J. Agata, L. Chao, and J. Chao
Kallistatin is a new inhibitor of angiogenesis and tumor growth
Blood, October 16, 2002; 100(9): 3245 - 3252.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. J. Campbell, B. Dixon, A. Kladis, M. Kemme, and J. D. Santamaria
Activation of the kallikrein-kinin system by cardiopulmonary bypass in humans
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2001; 281(4): R1059 - R1070.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Q. Miao, H. Murakami, Q. Song, L. Chao, and J. Chao
Kallistatin Stimulates Vascular Smooth Muscle Cell Proliferation and Migration In Vitro and Neointima Formation in Balloon-Injured Rat Artery
Circ. Res., March 3, 2000; 86(4): 418 - 424.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
H. Murakami, K. Yayama, R. Q. Miao, C. Wang, L. Chao, and J. Chao
Kallikrein Gene Delivery Inhibits Vascular Smooth Muscle Cell Growth and Neointima Formation in the Rat Artery After Balloon Angioplasty
Hypertension, August 1, 1999; 34(2): 164 - 170.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wolf, W. C.
Right arrow Articles by Chao, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolf, W. C.
Right arrow Articles by Chao, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact