Journal of Histochemistry and Cytochemistry Priciples for Free Access to Science
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giles, M. E.
Right arrow Articles by Oldfield, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giles, M. E.
Right arrow Articles by Oldfield, B. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Journal of Histochemistry and Cytochemistry, Vol. 47, 507-516, April 1999, Copyright © 1999, The Histochemical Society, Inc.


ARTICLE

Characterization of a Specific Antibody to the Rat Angiotensin II AT1 Receptor

Michelle E. Gilesa, Ross T. Fernley1,a, Yoshio Nakamura2,a, Ingrid Moellera, G. Peter Aldred3,a, Tania Ferraroa, Jennifer D. Penschow4,a, Michael J. McKinleya, and Brian J. Oldfielda
a The Howard Florey Institute of Experimental Physiology and Medicine, Parkville, Victoria, Australia

Correspondence to: Brian J. Oldfield, Howard Florey Inst. of Experimental Physiology and Medicine, Univ. of Melbourne, Parkville, Victoria 3052, Australia.


*   Summary
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

We raised a polyclonal antibody against a decapeptide corresponding to the carboxyl terminus of the rat angiotensin II AT1 receptor. This antibody was demonstrated to be specific for the rat receptor according to a number of approaches. These included (a) the ultrastructural localization of immunogold-labeled receptor on the surfaces of zona glomerulosa cells in the adrenal cortex, (b) the specific labeling of Chinese hamster ovarian (CHO) cells transfected with AT1 receptors, (c) the identification of a specific band on Western blots, (d) the immunocytochemical co-localization of angiotensin receptors on neurons in the lamina terminalis of the brain shown to be responsive to circulating angiotensin II, as shown by the expression of c-fos, and (e) the correlation between the expression of the mRNA of the AT1 receptor and AT1 receptor immunoreactivity. (J Histochem Cytochem 47:507–515, 1999)

Key Words: angiotensin II, AT1 receptor, lamina terminalis


*   Introduction
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

The octapeptide hormone angiotensin II (Ang II) plays a key role in the regulation of blood pressure and fluid homeostasis through its actions on peripheral target organs and tissues as well as its putative role as a neurotransmitter (Mendelsohn et al. 1990 Down). The Ang II receptor has been classified into two main subtypes designated AT1 and AT2 (Murphy et al. 1991 Down; Timmermans et al. 1992 Down; Inagami and Kitami 1994 Down). The AT1 receptor appears to mediate most of the physiological actions of Ang II (Bottari et al. 1993 Down; see McKinley et al. 1996 Down). cDNA clones encoding both types of receptors have been isolated and the sequences determined (Murphy et al. 1991 Down; Sasaki et al. 1991 Down; Nakajima et al. 1993 Down). In the rat there is only 32% sequence homology between the AT1 and AT2 receptors. Two forms of the rat (and mouse) AT1 receptor (AT1A and AT1B) have been identified and sequenced and these have about 96% sequence identity in the coding region (Inagami and Kitami 1994 Down). The deduced sequence of the rat AT1 receptor shows a protein of 359 amino acids with a molecular weight of 41 kD, seven putative transmembrane domains, and three potential glycosylation sites (Murphy et al. 1991 Down).

The anatomic localization of Ang II receptors and their subtypes in the brain (Mendelsohn et al. 1984 Down; Rowe et al. 1990 Down; Song et al. 1992 Down), kidney, pituitary, and adrenal (Zhuo et al. 1995 Down) has been greatly facilitated in the past decade through in vitro autoradiographic methods utilizing radioactively tagged antagonist analogues such as (125I [Sar1, Ile8])-Ang II, used alone or in conjunction with unlabeled peptide antagonists, to differentiate the distributions of AT1 and AT2 receptors. These approaches have been paralleled by the anatomic identification of mRNAs for these receptors (Bunnemann et al. 1992 Down; Lenkei et al. 1995 Down). The clear limitation of autoradiographic studies to localize receptors is one of resolution. Typically, such experiments involve unfixed, frozen sections and radioactive labels, and therefore are relatively incompatible with cellular and subcellular resolution and prohibit the co-localization of other peptides, enzymes, or neurotransmitters. To further our studies of the role of Ang II, particularly in pathways in the brain that mediate fluid and electrolyte homeostasis and control of blood pressure, we required an antibody to the peptide receptor that would offer high resolution, specificity and compatibility with other techniques. To this end, we raised antibodies that bind to the AT1 receptor for use in immunocytochemistry at both the light and electron microscopic levels. Although similar antibodies have been produced recently, none, to our knowledge, has been sufficiently well characterized to allow detailed anatomic studies. The antisera described here have been utilized to show the distribution of AT1 receptor in the brain and adrenal gland (at both the light and the electron microscopic level) and the localization of receptors specifically on neurons sensitive to blood-borne Ang II, as shown by their elevated content of Fos protein after treatment with the ß-adrenergic agonist isoproterenol, a stimulus known to increase blood Ang levels resulting from increased renin secretion.


*   Materials and Methods
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Peptide Synthesis and Antibody Production
The decapeptide corresponding to the carboxyl terminal sequence of the rat AT1A receptor (Murphy et al. 1991 Down) was synthesized by the Boc method and purified by high-performance liquid chromatography (HPLC). The peptide has an amino-terminal Lys residue (KKPASCFEVE) and this was used to conjugate the peptide to keyhole limpet hemocyanin using glutaraldehyde (Rondeau et al. 1990 Down). Antibodies were raised by injecting the equivalent of 0.1 mg of peptide per injection into each of five rabbits at 4-week intervals. Bleeds were taken from the ear vein and the serum tested for antibodies to the peptide by dot-blot analysis.

AT1A Receptor Cloning and Riboprobe Synthesis
RNA from rat liver was isolated by conventional methods (Chomczynski and Sacchi 1987 Down). RNA (0.5 µg) was reverse-transcribed in a 25-µl reaction containing 100 mM KCl, 50 mM Tris-HCl (pH 8.4), 6 mM MgCl2, 10 mM dithiothreitol, 500 µM dNTPs (Progen; Queensland, Australia), 50 ng specific primer (5'GGTAAACATACATTGCC 3', complementary to position 1890 of the rat sequence) (Murphy et al. 1991 Down), 40 U RNasin (Progen), and AMV reverse transcriptase (Boehringer, Mannheim, Germany; 25 U) at 42C for 1 hr.

An aliquot of the reverse transcription reaction (1 µl) was used in the polymerase chain reaction. The primers used for amplification of the AT1A receptor mRNA were: sense 5'GTGGATTTCGAATAGTGTCTGAGAC 3'; anti-sense 5'TAAAGATGTTCACGTATGTGGAGAA 3'; corresponding to regions -47 to -23 and 1852–1828 of the rat AT1A receptor, respectively (Murphy et al. 1991 Down). PCR was performed in a reaction containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 400 µM dNTPs, Taq polymerase (Bresatec, Adelaide, Australia; 2.5 U), 3 µM MgCl2, and each primer at 400 nM. Denaturation, annealing, and extension were carried out at 94C, 60C, and 72C, respectively, for 1 min each for 30 cycles, followed by a final extension at 72C for 10 min. The resulting 1.89-KB polymerase chain reaction (PCR) product was cloned into the Sma site of pBluescript II SK+ to form the plasmid pAT1A.

Anti-sense (HindIII cut, T3 polymerase) and sense (BamHI cut, T7 polymerase) probes were synthesized from the plasmid pAT1A. The probes were labeled by incorporating [35S]-UTP into the synthesis reaction, using the Stratagene in vitro transcription kit (Stratagene; La Jolla, CA).

Western Analysis
Western blot analysis was performed using AT1A receptor-transfected or nontransfected CHO cells. Cells were maintained in Ham's F-12 medium containing 10% fetal calf serum. Geneticin (500 µg/ml) was added to the medium for transfectant cells (Teutsch et al. 1992 Down). At confluence, cells were washed twice with PBS and harvested in PBS containing peptidase inhibitors [5 mM EDTA, 1 mM benzamidine, 5 µg/ml pepstatin A, 0.1 mg/ml phenanthroline, 10 µM leupeptin, 1 µg/ml soybean trypsin inhibitor, and 1 mM phenyl methyl sulfonyl fluoride (PMSF)]. Cell membranes were prepared by homogenizing cells in the above buffer. Then the homogenate was centrifuged at 500 x g for 5 min at 4C. The supernatant was then centrifuged at 50,000 x g for 30 min at 4C. The membrane pellet was subjected to a Dounce homogenizer in the above buffer. Protein content of the membrane samples was measured using the Bradford reagent (Bio-Rad; Hertfordshire, UK). Membrane samples (3 µg protein) were treated with sample loading buffer (Curnow et al. 1995 Down) at room temperature (RT) for 2 hr, and loaded into 10% SDS-polyacrylamide gels. Electrophoresis was performed in a standard protocol as described (Sambrook et al. 1989 Down). The resolved proteins were transferred by electroblotting onto a nitrocellulose sheet, Hybond C-Extra (Amersham; Poole, UK). The nitrocellulose sheet was rinsed in 0.1% Tween-20/20 mM Tris-HCl (pH 7.5)/0.5 M NaCl (T-TBS), soaked in blocking solution [T-TBS containing 5% skim milk and 3% bovine serum albumin (BSA)] at RT for 1 hr. After a wash in T-TBS, the sheet was incubated with antiserum at 1:1000 dilution in 1% BSA/T-TBS at RT for 1 hr, washed in T-TBS, then incubated with peroxidase-labeled goat anti-rabbit secondary antibody at 1:3000 dilution (Bio-Rad) at RT for 1 hr. Specific bands were visualized with chemiluminescence, ECL Western Blotting Detecting Kit (Amersham). Rainbow marker (Amersham) was used as molecular weight size standards.

Hybridization Histochemistry
Probes. Hybridization histochemistry was performed according to a standard protocol (Beck et al. 1994 Down). Briefly, paraffin-embedded sections 7 µm thick were cut and mounted on 2% silane-coated slides. Deparaffinized sections were treated with pronase E (Sigma; St Louis, MO) (125 µg/ml) for 20 min at 37C, postfixed in 4% paraformaldehyde, dried, covered with approximately 40 µl of diluted riboprobe (0.2 ng/ml; see above), and incubated for 16 hr at 50C in a humidified chamber. Sections were then thoroughly washed in formamide buffer at 50C and treated with RNase A (Sigma; 150 µg/ml) for 2 hr at 37C. After digestion the sections were washed at 65C in 2 x SSC, then dried. The slides were exposed to phosphor imaging plates (Fuji Photo Film Co; Tokyo, Japan) for 2 nights and then scanned using a Bioimaging analyzer (Fujix BAS 2000). Slides were dipped in K5 liquid emulsion (Ilford; Cheshire, UK) diluted 1:1.5 with distilled water and exposed at RT for 12–24 days. Emulsions were then developed and sections counterstained with hematoxylin and eosin.

Immunohistochemistry
Light Microscopy. Male Sprague–Dawley rats were anesthetized with sodium pentobarbital (100 mg/kg IP) and perfused transcardially with 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.2. The brain and adrenal glands were postfixed in the above fixative for 2 hr and then transferred to 20% sucrose in phosphate buffer overnight. Coronal frozen sections (40 µm) were taken throughout the preoptic hypothalamic area, medulla oblongata, and adrenal glands. These sections were exposed free-floating to 10% normal horse serum for 1 hr at RT before an overnight incubation in the AT1 receptor antibody diluted in phosphate buffer containing 2% normal horse serum and 0.3% Triton X-100 (BDH Chemicals; Victoria, Australia).

Electron Microscopy. The procedure for preparation of material for electron microscopy was based on a protocol for whole mounts (Young et al. 1994 Down) and was applied to vibratome sections as follows. Briefly, rats were perfused transcardially with 4% paraformaldehyde and 0.05% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4, and the adrenal glands were removed and postfixed in alkaline 4% paraformaldehyde overnight at 4C. Glands were washed thoroughly in phosphate buffer and then vibratome sections 100 µm thick were cut and immersed sequentially in 50% alcohol, phosphate buffer, 1% sodium borohydride, and again in phosphate buffer. The sections were blocked in 0.01 M phosphate buffer saline (pH 7.2) containing 1% bovine serum albumin, 1% fish gelatin (Sigma), and 10% normal horse serum for 30 min. The primary antibody was diluted in the above blocking buffer with the addition of 0.05% merthiolate and was applied to free-floating sections for 48 hr at 4C. After incubation the sections were washed in 0.01 M PBS, pH 7.2. They were then incubated with 1-nm gold secondary antibody (Amersham) diluted in the blocking buffer with 0.2% acetylated bovine serum albumin (aBSA) (Electron Microscopy Sciences; Warrington, PA), for 48 hr at 4C. Postfixation in 2% glutaraldehyde and further washes in distilled water followed washes in the blocking buffer and 0.01 M PBS, pH 7.2. Sections then underwent contrast staining and further fixation with 1.25% osmium tetroxide and 2% uranyl acetate. Sections were then silver-enhanced (Amersham), processed to Araldite/Epon according to standard methods, then flat-embedded and attached to blank polymerized resin blocks. Ultrathin sections were taken and collected on copper grids, then counterstained with 10% uranyl acetate and lead citrate for 5 min.

Chinese Hamster Ovarian (CHO) Cells In Vitro. CHO cells that had been transfected with the rat AT1A receptor were subjected to immunohistochemical procedures, as were nontransfected CHO cells. The cells were dipped in acetone, air-dried, and fixed in 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.2, for 5 min. The cells were then washed in phosphate buffer and the above light microscopic immunohistochemical method was used to identify the AT1 receptor.

Stimulation of Ang II-responsive Neurons in the Circumventricular Organs of the Rat Brain: A Comparison of the Distribution of Fos Protein and the AT1 Receptor
Animals. Six Sprague–Dawley rats were injected SC with 50 µg/kg isoproterenol (Isuprel Winthrop) to elevate endogenous circulating levels of Ang II. Two hr later, rats were deeply anesthetized with sodium pentobarbital (100 mg/kg IP) and were then perfused transcardially with isotonic saline (80 ml) followed by 4% paraformaldehyde (250 ml).

Dual Labeling of AT1 Receptor and Fos Protein. To immunocytochemically double label groups of neurons that had elevated levels of Fos protein and also expressed the AT1 receptor, specific antibodies raised against each of these were applied (as above) sequentially to free-floating sections.

First, Fos protein was identified using a commercial antibody raised against residues 4–17 of human Fos (c-fos Ab-2; Oncogene Science, Manhasset, NY). This antigen was visualized in neuronal cell nuclei as a black reaction product by virtue of the inclusion of 40% nickel ammonium chloride in the diaminobenzidine solution. Subsequently, the AT1 receptor (see above) was localized using the same chromogen without nickel ammonium chloride, which results in a brown reaction product. The primary antibodies in each case were visualized using avidin–biotin–peroxidase procedures (Vector; Burlingame, CA).


*   Results
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Western Blot Analysis
The antibody detected a major band at approximately 70–80 kD in membranes from CHO cells transfected with rat AT1A receptors (Figure 1, Lane 4), but not from untransfected CHO cells (Figure 1, Lanes 1, 3, and 5). No bands were detected either with nonimmune rabbit serum (Figure 1, Lane 2) or with the mixture of antiserum after preincubation with the decapeptide (1 µM) used to raise the antibody (Figure 1, Lane 6).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 1. Western blots on membranes of CHO cells. Lanes 1, 3, 5, nontransfected CHO cells that have had nonimmune rabbit serum or AT1 antiserum or preabsorbed AT1 antiserum applied, respectively. Lanes 2, 4, 6, CHO cells transfected with the AT1 construct.

Immunocytochemistry and Hybridization Histochemistry of the AT1 Receptor in CHO Cells
Antiserum applied to CHO cells transfected with the AT1 receptor resulted in an intense reaction product throughout the cell bodies and their processes (Figure 2a). This staining was abolished by preabsorption of the antibody with the 20 µg/ml of the peptide for 1 hr at 37C before to application to cells (Figure 2b). Similarly, when the primary antibody was omitted from the immunocytochemical protocol, cell staining was not apparent (Figure 2c). Despite the lack of staining in the latter cases (Figure 2b and Figure 2c), the outlines of cells could be discerned using interference contrast optics. Nontransfected CHO cells did not exhibit any immunoreactivity when exposed to the AT1 receptor antiserum (data not shown).



View larger version (71K):
[in this window]
[in a new window]
 
Figure 2. Cultures of CHO cells transfected with the AT1 receptor exposed to (a) AT1 receptor antiserum, (b) antiserum preabsorbed with 20 µg/ml of peptide, or (c) nonimmune antiserum. Bar = 40 µm.

Adrenal Gland
In the rat adrenal cortex, immunohistochemistry at the light microscopic level showed intense labeling of virtually all cells in the zona glomerulosa. The immunoreactivity was most intense on the plasma membrane of these cells (Figure 3a and Figure 3b). Although there was some immunoreactivity in the zona fasciculata, this was of a low intensity compared with the neighboring zona glomerulosa. Preabsorption of the antiserum with 20 µg/ml of the C-terminal decapeptide completely abolished all immunostaining. Comparison of the distribution of the AT1A receptor peptide, as shown by immunocytochemistry, with that of its mRNA, demonstrated with hybridization histochemistry, indicated that the distributions were essentially the same (Figure 3c and Figure 3d). When cells were examined at the ultrastructural level, it could be confirmed that immunoreaction product was restricted to the plasma membranes of cells in the zona glomerulosa (Figure 4a and Figure 4b), whereas closely adjacent cells in the capsule or in the zona fasciculata (the latter distinguished on the basis of the characteristic appearance of their mitochondria; Figure 4b) were unlabeled.



View larger version (91K):
[in this window]
[in a new window]
 
Figure 3. AT1 receptor antisera or riboprobe to the receptor applied either to sections of the adrenal gland (a–d) or to coronal sections of the organum vasculosum lamina terminalis (OVLT) of the forebrain (e–h). Sections in c and g are counterstained sections hybridized with AT1 receptor riboprobe of adrenal gland and OVLT respectively. The same sections were photographed using darkfield illumination in d and h. Arrows in b indicate immunoreactivity associated with the membrane of cells in the zona glomerulosa (zg). Arrowhead in e shows immunoreactivity in the lateral boundaries of the OVLT, which corresponds to high levels of AT1 mRNA in the same region (arrowhead in h). Immunoreactivity in the OVLT (f) was preabsorbed with 20 µg/ml of peptide. Bars: a = 200 µm; e = 90 µm.



View larger version (81K):
[in this window]
[in a new window]
 
Figure 4. Electron micrographs of the rat adrenal gland showing AT1 receptor immunoreactivity. (a) The adrenal capsule (C) attached to cells of the zona glomerulosa (zg), which have silver grains on their membranes (arrowheads). Bar = 2 µm. (b) Silver grains (arrowheads) on the membrane of the zg cell but not on the adjacent zona fasciculata (zf) cell. Bar = 1 µm.

Brain
The AT1 receptor was found in discrete areas of the brain, most notably in the components of the lamina terminalis of the forebrain, i.e., the organum vasculosum lamina terminalis (OVLT) (Figure 3e), the median preoptic nucleus (MnPO) (not shown), the subfornical organ (SFO) (Figure 5a), and the nucleus of the solitary tract of the medulla oblongata (not shown). More specifically, reaction product was concentrated in the lateral margins of the OVLT and in the central (and ventral) regions of the SFO. It is precisely these areas that showed high levels of mRNA for the AT1 receptor when hybridization histochemistry using 35S-labeled riboprobes was performed on sections of the forebrain (OVLT, Figure 3g and Figure 3h; SFO, Figure 5c and Figure 5d). Immunostaining of either nerve fibers or cell bodies was also found in a range of brain regions throughout the remainder of the preoptic region, diencephalon, and hindbrain. In these areas labeling was most prominent in the anteroventral preoptic nucleus, anterior parvocellular division of the paraventricular nucleus, lateral hypothalamic area, anterior periventricular nucleus, retrochiasmatic area, lateral hypothalamus, and dorsomedial hypothalamus. Faint labeling could also be detected in the forebrain in the bed nucleus of the stria terminalis and the suprachiasmatic nucleus, and in the caudal and rostral ventrolateral medulla. Preabsorbing the antiserum with the C-terminal decapeptide, (see OVLT, Figure 3f, and SFO, Figure 5b) abolished all immunostaining.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 5. Coronal sections through the rat subfornical organ (SFO) (a–h) and OVLT (e,f). AT1 receptor immunoreactivity in the SFO (a), indicated with an arrowhead, is abolished after preabsorption of the antiserum with 20 µg/ml of peptide (b). SFO sections in brightfield (c) and darkfield (d), with the arrowhead pointing to the hybridization labeling after application of the AT1 receptor riboprobe. Immunohistochemical double labeling in the OVLT (e,f) and SFO (g,h) of the AT1 receptor (single arrowhead) and Fos protein (double arrowhead). The small box in e is enlarged in f and the small box in g is enlarged in h. Bars: a = 100 µm; e = 200 µm; h = 50 µm.

After an SC injection of isoproterenol to elevate endogenous levels of circulating Ang II, a close anatomic correlation was found in the OVLT and SFO between activated neurons, identified by an elevation of Fos protein, and those expressing the AT1 receptor. In the OVLT, this co-distribution was prominent and complete in the lateral margins of the nucleus (Figure 5e and Figure 5f) whereas in the SFO there was greatest overlap in its central and ventral aspect (Figure 5g and Figure 5h). An SC injection of isotonic saline revealed no immunoreactivity for Fos protein in these brain regions (McKinley et al. 1992 Down).


*   Discussion
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

The peptide chosen for raising antibodies corresponded to a decapeptide at the carboxyl terminus of the rat AT1A receptor. This is often the most suitable region of a protein for raising antibodies, which will recognize the entire protein (Siemens et al. 1994 Down). The sequence used is likely to be unique to the rat AT1A receptor, based on a search of the Swiss Protein database (not shown).

The antibody appears, by a number of clearly defined criteria, to be specific. It binds specifically to cells in the zona glomerulosa of the adrenal gland and in a number of discrete brain regions, including the subfornical organ, organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus, bed nucleus of the stria terminalis, paraventricular nucleus of the hypothalamus, and nucleus of the solitary tract. These brain sites correspond well to those shown to possess high levels of the AT1 receptor by in vitro autoradiographic localization (Mendelsohn et al. 1984 Down; Gehlert et al. 1986 Down) and mRNA (Lenkei et al. 1997 Down). Furthermore, the specific regional location of AT1 receptors, shown recently in the central core of the subfornical organ and in the lateral margins of the OVLT using both hybridization histochemistry and the Fos response to increased circulating levels of Ang II (see Figure 3e–h and Figure 5) (Lenkei et al. 1995 Down, Lenkei et al. 1997 Down; McKinley et al. 1998 Down; McKinley and Oldfield 1998 Down), coincide exactly with the distribution of receptors demonstrated with the antibody in the present study. The subfornical organ and the OVLT lack a blood–brain barrier, and neurons in these circumventricular organs, unlike those in most other regions of the brain, are exposed to circulating Ang II. There is considerable evidence indicating that neurons in these sites are responsive to Ang II, mediate the drinking response and vasopressin secretion caused by blood-borne Ang II (Simpson 1981 Down), and increase the expression of Fos when stimulated by Ang II (McKinley et al. 1992 Down).

The AT1A receptor antibody was also shown to be specific for the AT1 receptor by Western blotting. The antibody demonstrated strong binding to CHO cells transfected with the AT1A receptor but not to nontransfected cells. Furthermore, neither nonimmune serum nor immune serum preincubated with the decapeptide used to raise the antibody crossreacted significantly with the extracts from CHO cells transfected with the AT1A receptor.

The broad band of labeling in the extracts from transfected cells is most likely due to differential glycosylation of the AT1A receptor. Although the predicted mass for the AT1A receptor is ~41 kD, the receptor contains three potential glycosylation sites and the observed mobility is consistent with glycosylation. A similar size distribution of an epitope-tagged AT1A receptor has previously been demonstrated (Oppermann et al. 1996 Down).

Although the need for immunocytochemical localization of the AT1 receptor has been recognized for some time, there has been little evidence that an appropriate antibody was forthcoming. Most recently, such an antibody has been used (Phillips et al. 1993 Down) and sold commercially (Chemicon International; Temecula, CA). However, the description of receptor labeling using this antiserum is in certain instances, such as in the supraoptic nucleus (Phillips et al. 1993 Down; Ying et al. 1995 Down) or the magnocellular portion of the paraventricular nucleus of the hypothalamus (Dawson et al. 1998 Down), at odds with the accumulated evidence from hybridization histochemistry (Lenkei et al. 1997 Down) and in vitro receptor autoradiography (Rowe et al. 1990 Down; Song et al. 1992 Down). The supporting evidence provided in the present study from Western blots, electron microscopy, detection of receptor transfected into CHO cells, combination with Fos studies, and correspondence with the distribution of AT1 receptor mRNA give confidence that a polyclonal antisera has been obtained that is specific for the AT1 receptor. This antibody clearly has potential for the precise cellular and subcellular localization of this receptor in organs and tissues of the rat and can be used in combination with other histological techniques.


*   Footnotes

1 Present address: Biomolecular Research Institute, Parkville, Victoria, Australia. Back
2 Present address: Department of Geriatric Medicine, Oska University Medical School, Suita, Osaka, Japan. Back
3 Present address: School of Science, University of Ballarat, Mt Helen, Victoria, Australia. Back
4 Present address: Department of Biochemistry, University of Tasmania, Hobart, Australia. Back


*   Acknowledgments

Supported by the National Health and Medical Research Council of Australia Block Grant 983001.

We would like to thank Dr Pierre Corvol and Dr Eric Clauser for their kind gift of CHO cells transfected with the AT1A receptor, and Dr John Wade for synthesizing the peptide.

Received for publication November 19, 1998; accepted December 1, 1998.


*   Literature Cited
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Beck F, Tucci J, Senior P (1994) Tissue distribution of gene expression in mammalian development. Methods Mol Biol 33:313-343[Medline]

Bottari SP, DeGasparo M, Steckellings UM, Levens NR (1993) Angiotensin II receptor subtypes—characterisation, signalling mechanisms, and possible physiological implications. Frontiers Neuroendocrinol 14:123-171[Medline]

Bunnemann B, Iwai N, Metzger R, Fuxe K, Inagami T, Ganten D (1992) The distribution of angiotensin II AT1 receptor subtype in the rat brain. Neurosci Lett 142:155-158[Medline]

Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159[Medline]

Curnow KM, Pascoe L, Davies E, White PC, Corvol P, Clauser E (1995) Alternatively sliced human type 1 angiotensin II receptor mRNAs are translated at different efficiencies and encode two receptor isoforms. Mol Endocrinol 9:1250-1262[Abstract/Free Full Text]

Dawson CA, Jhamandas JH, Krukoff TL (1998) Activation by systemic angiotensin II of neurochemically identified neurons in rat hypothalami paraventricular nucleus. J Neuroendocrinol 10:453-459[Medline]

Gehlert DR, Speth RC, Walmsley JK (1986) Distribution of [125I] angiotensin II binding sites in the rat brain: a quantitative autoradiographic study. Neuroscience 18:837-856[Medline]

Inagami T, Kitami Y (1994) Angiotensin II receptor: molecular cloning, functions and regulation. Hypertens Res 17:87-97

Lenkei Z, Corvol P, Llorens–Cortes C (1995) The angiotensin receptor subtype AT1A predominates in rat forebrain areas involved in blood pressure, body fluid homeostasis and neuroendocrine control. Brain Res Mol Brain Res 30:53-60[Medline]

Lenkei Z, Palkovits M, Corvol P, Llorens–Coretes C (1997) Expression of angiotensin Type 1 (AT1) and Type 2 (AT2) receptor mRNAs in the adult brain: a functional neuroanatomical review. Frontiers Neuroendcrinol 18:383-439

McKinley MJ, Allen AM, Burns P, Colvill LM, Oldfield BJ (1998) Interaction of irculating hormones with the brain: the roles of the subfornical organ and OVLT. Clin Exp Pharmacol Physiol 25(suppl):S61-67

McKinley MJ, Badoer E, Oldfield BJ (1992) Intravenous angiotensin II induces Fos-immunoreactivity in circumventricular organs of the lamina terminalis. Brain Res 594:295-300[Medline]

McKinley MJ, McAllen RM, Pennington GL, Smardencas A, Weisinger RS, Oldfield BJ (1996) Physiological actions of angiotensin II mediated by AT1 and AT2 receptors in the brain. Clin Exp Pharmacol Physiol Suppl 3:S99-104[Medline]

McKinley MJ, Oldfield BJ (1998) The brain as an endocrine target for peptide hormones. Trends Endocrinol Metab 9:349-354[Medline]

Mendelsohn FAO, Allen AM, Chai S-Y, McKinley MJ, Oldfield BJ, Paxinos G (1990) The brain angiotensin system. Insights from mapping its components. Trends Endocrinol Metab 1:189-198

Mendelsohn FAO, Quirion R, Saavedra JM, Augilera G, Catt KJ (1984) Autoradiographic localisation of angiotensin II receptors in rat brain. Proc Natl Acad Sci USA 81:1575-1579[Abstract/Free Full Text]

Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE (1991) Isolation of a cDNA encoding the vascular type 1 angiotensin II receptor. Nature 351:233-236[Medline]

Nakajima M, Mukoyama N, Pratt RE, Horiuchi M, Dzau VJ (1993) Cloning of cDNA and analysis of the gene for mouse angiotensin type 2 receptor. Biochem Biophys Res Commun 197:393-399[Medline]

Oppermann M, Freedman NJ, Alexander RW, Lefkowitz RJ (1996) Phosphorylation of the type 1A angiotensin II receptor by G protein-coupled receptor kinases and protein kinase C. J Biol Chem 271:13266-13272[Abstract/Free Full Text]

Phillips MI, Shen L, Richards EM, Raizoda MK (1993) Immunohistochemical mapping of angiotensin AT1 receptors in the brain. Regul Pept 44:95-107[Medline]

Rondeau JJ, McNicoll N, Escher E, Meloche S, Ong H, DeLean A (1990) Hydrodynamic properties of the angiotensin II receptor from bovine adrenal zona glomerulosa. Biochem J 268:443-448[Medline]

Rowe BP, Grove KL, Saylor DL, Speth RC (1990) Angiotensin receptor subtypes in the rat brain. Eur J Pharmacol 186:339-342[Medline]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press

Sasaki K, Yamano Y, Bardhan S, Iwai N, Murray JJ, Hasegawa M, Matsuda Y, Inagami T (1991) Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type 1 receptor. Nature 351:230-232[Medline]

Siemens IR, Yee DK, Reagan LP, Fluharty SJ (1994) Affinity purification of angiotensin type 2 receptors from N1E-115 cells: evidence for agonist-induced formation of multimeric complexes. J Neurochem 62:257-264[Medline]

Simpson JB (1981) The circumventricular organs and the central actions of angiotensin. Neuroendocrinology 32:248-256[Medline]

Song K, Allen AM, Paxinos G, Mendelsohn FAO (1992) Mapping of angiotensin II receptor subtype heterogeneity in rat brain. J Comp Neurol 316:467-484[Medline]

Teutsch B, Bihoreau C, Monnot C, Bernstein K, Murphy T, Alexander R, Corvol P, Clauser E (1992) A recombinant rat vascular AT1 receptor confers growth properties to angiotensin II in Chinese hamster ovary cells. Biochem Biophys Res Commun 187:1381-1388[Medline]

Timmermans PBMWM, Chiu AT, Herblin WF, Wong PC, Smith RD (1992) Angiotensin II receptor subtypes. Am J Hypertens 5:406-410[Medline]

Ying Z, Livreri S, Buggy J (1995) C-fos induced by angiotensin and hyperosmolality in SON and PVN neurons expressing AT1 receptor. Soc Neurosci Abst 348:11

Young HM, Kunze WAA, Pompolo S, Furness JB, Bornstein JC (1994) Combined intracellular injection of neurobiotin and preembedding immunocytochemistry using silver-intensified gold probes in myerteric neurons. J Neurosci Methods 51:39-45[Medline]

Zhuo J, Allen AM, Alcorn D, Aldred GP, MacGregor DP, Mendelsohn FAO (1995) The distribution of angiotensin II receptors. In Larah JH, Brenner BM, eds. Hypertension: Pathophysiology, Diagnosis and Management. 2nd Ed. New York, Raven Press, 1739-1762


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Physiol.Home page
P. Shi, M. A. Martinez, A. S. Calderon, Q. Chen, J. T. Cunningham, and G. M. Toney
Intra-carotid hyperosmotic stimulation increases Fos staining in forebrain organum vasculosum laminae terminalis neurones that project to the hypothalamic paraventricular nucleus
J. Physiol., November 1, 2008; 586(21): 5231 - 5245.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
D. Daniels, D. K. Yee, and S. J. Fluharty
Hydromineral Neuroendocrinology: Angiotensin II receptor signalling
Exp Physiol, May 1, 2007; 92(3): 523 - 527.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
M. Fry, T. D. Hoyda, and A. V. Ferguson
Making Sense of It: Roles of the Sensory Circumventricular Organs in Feeding and Regulation of Energy Homeostasis
Experimental Biology and Medicine, January 1, 2007; 232(1): 14 - 26.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. M. Baker and R. Kumar
Intracellular angiotensin II induces cell proliferation independent of AT1 receptor
Am J Physiol Cell Physiol, November 1, 2006; 291(5): C995 - C1001.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Shekhar, P. L. Johnson, T. J. Sajdyk, S. D. Fitz, S. R. Keim, P. E. Kelley, D. R. Gehlert, and J. A. DiMicco
Angiotensin-II Is a Putative Neurotransmitter in Lactate-Induced Panic-Like Responses in Rats with Disruption of GABAergic Inhibition in the Dorsomedial Hypothalamus
J. Neurosci., September 6, 2006; 26(36): 9205 - 9215.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. M. Allen, J. K. Dosanjh, M. Erac, S. Dassanayake, R. D. Hannan, and W. G. Thomas
Expression of Constitutively Active Angiotensin Receptors in the Rostral Ventrolateral Medulla Increases Blood Pressure
Hypertension, June 1, 2006; 47(6): 1054 - 1061.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. J. Somponpun, A. K. Johnson, T. Beltz, and C. D. Sladek
Estrogen receptor-{alpha} expression in osmosensitive elements of the lamina terminalis: regulation by hypertonicity
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2004; 287(3): R661 - R669.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Wu, W. Zheng, and K. Sandberg
Estrogen Regulates Adrenal Angiotensin Type 1 Receptors by Modulating Adrenal Angiotensin Levels
Endocrinology, April 1, 2003; 144(4): 1350 - 1356.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. M. Moritz, K. Johnson, R. Douglas-Denton, E. M. Wintour, and M. Dodic
Maternal Glucocorticoid Treatment Programs Alterations in the Renin-Angiotensin System of the Ovine Fetal Kidney
Endocrinology, November 1, 2002; 143(11): 4455 - 4463.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. Lazartigues, S. M. Dunlay, A. K. Loihl, P. Sinnayah, J. A. Lang, J. J. Espelund, C. D. Sigmund, and R. L. Davisson
Brain-Selective Overexpression of Angiotensin (AT1) Receptors Causes Enhanced Cardiovascular Sensitivity in Transgenic Mice
Circ. Res., March 22, 2002; 90(5): 617 - 624.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. F R Paton, J. Deuchars, Z. Ahmad, L-F Wong, D. Murphy, and S. Kasparov
Adenoviral vector demonstrates that angiotensin II-induced depression of the cardiac baroreflex is mediated by endothelial nitric oxide synthase in the nucleus tractus solitarii of the rat
J. Physiol., March 1, 2001; 531(2): 445 - 458.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
A. M Allen, M. E Giles, J. Lee, B. J Oldfield, F. A. Mendelsohn, and M. J McKinley
Review: AT1-receptors in the central nervous system
Journal of Renin-Angiotensin-Aldosterone System, March 1, 2001; 2(1_suppl): S95 - S101.
[PDF]


Home page
Circ. Res.Home page
E. Lazartigues, S. M. Dunlay, A. K. Loihl, P. Sinnayah, J. A. Lang, J. J. Espelund, C. D. Sigmund, and R. L. Davisson
Brain-Selective Overexpression of Angiotensin (AT1) Receptors Causes Enhanced Cardiovascular Sensitivity in Transgenic Mice
Circ. Res., March 22, 2002; 90(5): 617 - 624.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giles, M. E.
Right arrow Articles by Oldfield, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giles, M. E.
Right arrow Articles by Oldfield, B. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact