Journal of Histochemistry and Cytochemistry
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Waguri, S.
Right arrow Articles by Uchiyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Waguri, S.
Right arrow Articles by Uchiyama, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Histochemistry and Cytochemistry, Vol. 49, 1397-1406, November 2001, Copyright © 2001, The Histochemical Society, Inc.


ARTICLE

Different Distribution Patterns of the Two Mannose 6-phosphate Receptors in Rat Liver

Satoshi Waguria, Mari Kohmuraa, Shiro Kanamoria, Tsuyoshi Watanabea, Yoshiyuki Ohsawaa, Masato Koikea, Yuji Tomiyamaa, Masaki Wakasugia, Eiki Kominamib, and Yasuo Uchiyamaa
a Department of Cell Biology and Neuroscience, Osaka University Graduate School of Medicine, Osaka, Japan
b Department of Biochemistry, Juntendo University School of Medicine, Tokyo, Japan

Correspondence to: Satoshi Waguri, Dept. of Cell Biology and Neuroscience (A1), Osaka U. Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan. E-mail: waguri@anat1.med.osaka-u.ac.jp


*   Summary
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Two mannose 6-phosphate receptors, cation-dependent and -independent receptors (CDMPR and CIMPR), play an important role in the intracellular transport of lysosomal enzymes. To investigate functional differences between the two in vivo, their distribution was examined in the rat liver using immunohistochemical techniques. Positive signals corresponding to CIMPR were detected intensely in hepatocytes and weakly in sinusoidal Kupffer cells and interstitial cells in Glisson's capsule. In the liver acinus, hepatocytes in the perivenous region showed a more intense immunoreactivity than those in the periportal region. On the other hand, positive staining of CDMPR was detected at a high level in Kupffer cells, epithelial cells of interlobular bile ducts, and fibroblast-like cells, but the corresponding signal was rather weak in hepatocytes. In situ hybridization analysis also revealed a high level of expression of CIMPR mRNAs in hepatocytes and of CDMPR mRNA in Kupffer cells. By double immunostaining, OX6-positive antigen-presenting cells in Glisson's capsule were co-labeled with the CDMPR signal but were only faintly stained with anti-CIMPR. These different distribution patterns of the two MPRs suggest distinct functional properties of each receptor in liver tissue. (J Histochem Cytochem 49:1397–1405, 2001)

Key Words: mannose 6-phosphate, receptors, immunofluorescence, hepatocytes, Kupffer cells, antigen-presenting cells, rat, liver


*   Introduction
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

NEWLY SYNTHESIZED LYSOSOMAL ENZYMES acquire mannose 6-phosphate (M6P) recognition signals that direct them from the trans-Golgi network (TGN) to the prelysosomal compartments. Two receptors, cation dependent- and -independent mannose 6-phosphate receptors (CD- and CIMPR), have been shown to be involved in this sorting function in mammalian cells. To date, differences in the properties of the two MPRs have been extensively studied using biochemical and cell biological approaches. CIMPR, a large transmembrane glycoprotein (Mr z300 kD), is also known as the insulin-like growth factor II (IGFII)/M6P receptor and contains two M6P-binding sites as well as a distinct IGF-II-binding site in the extracytoplasmic domain. On the other hand, CDMPR is a small receptor (Mr z46 kD) and has one M6P-binding site. It is believed that CDMPR exists as a dimer and/or tetramer on the membrane. Both receptors may appear on the cell surface, where they are then internalized. CIMPR, but not CDMPR, binds extracellular ligands (von Figura and Hasilik 1986 Down; Kornfeld and Mellman 1989 Down; Ludwig et al. 1995 Down; Dahms 1996 Down; Munier-Lehmann et al. 1996b Down). As to why the cells possess two MPRs, it has been demonstrated, by employing MPR-deficient fibroblasts, that each MPR preferentially binds different subgroups of lysosomal enzymes and, as a result, both receptors are required for the efficient sorting of lysosomal enzymes (Ludwig et al. 1994 Down; Pohlmann et al. 1995 Down; Kasper et al. 1996 Down; Munier-Lehmann et al. 1996a Down).

In contrast to the accumulated biochemical and cell biological data on the MPRs, only a few studies have appeared on the histological distribution of the two receptors (Valentino et al. 1988 Down, Valentino et al. 1990 Down; Ocrant et al. 1989 Down; Matzner et al. 1992 Down). By in situ hybridization (ISH), Matzner et al. 1992 Down demonstrated complementary expression patterns of these MPRs during mouse embryogenesis, suggesting unknown specific functions between the two MPRs. Another series of studies was performed on the immunohistochemical distribution of CIMPR as the IGF-II receptor, but not for CDMPR (Valentino et al. 1988 Down, Valentino et al. 1990 Down; Ocrant et al. 1989 Down). Although these studies have described the overall distribution of the MPRs in the body of rodents in some detail, their relative and precise distributions in various cell types which are located in several tissues continue to be unknown.

We have previously studied the distribution of lysosomal cysteine proteinases, cathepsins B, H, and L, in various tissues and found that they show heterogeneous distribution patterns depending on the enzymes, cells, and tissues (Uchiyama et al. 1994 Down). On the basis of these studies, we hypothesized that the two MPRs would also show different distribution patterns because they preferentially bind different subgroups of lysosomal enzymes (Ludwig et al. 1994 Down; Pohlmann et al. 1995 Down; Munier-Lehmann et al. 1996a Down). To test this hypothesis, we carefully investigated the tissue distribution of the two MPRs in the rat liver, using immunohistochemical (IHC) and in situ hybridization (ISH) methods. The collective findings indicate differences in the distribution patterns of the two receptors in the rat liver.


*   Materials and Methods
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Animals and Tissue Preparation
Four adult male Wistar rats (7 weeks of age, ~250 g) were deeply anesthetized with pentobarbital (25 mg/kg IP) and perfused via the portal vein first with 5 ml of physiological saline and then with 50 ml of 4% paraformaldehyde buffered with 0.1 M phosphate buffer (PB), pH 7.4, containing 4% sucrose. The liver tissue was excised, cut into small pieces, and immersed in the same fixative for 4 hr. After washing three times with the same buffer containing 7.5% sucrose, cryoprotection was ensured by infusing successively with 15% and 30% sucrose solutions, after which they were embedded with OCT compound. Cryosections were cut in 10-µm sections with a cryostat (Coldtome CM 501; Sakura, Tokyo, Japan) and mounted on gelatin-coated glass slides.

Antibodies
A rabbit polyclonal antibody against rat CIMPR was raised as reported previously (Muno et al. 1993 Down). An anti-CDMPR antibody was raised by immunizing rabbits with a synthetic peptide, the sequence of which corresponded to the cytoplasmic portion of CDMPR (KGMEQFPHLAFWQDL) as previously reported (Nadimpalli et al. 1991 Down; Kanamori et al. 1998 Down). Briefly, the peptide was synthesized by Bio-Synthesis (Lewisville, TX), purified by reverse-phase HPLC on Purosphere RP-18 (Cica-MERCK; Darmstadt, Germany), and confirmed by amino acid analysis. To immunize rabbits, the peptide was conjugated to keyhole limpet hemocyanin by reacting it with dimethyl adipimidate. The antiserum was purified by affinity chromatography using the synthetic peptide coupled to NHS-activated sepharose (HiTrap; Amersham Pharmacia Biotech, Poole, UK). An antibody against the entire cytoplasmic domain of CDMPR (MSCI-III-7b) was kindly provided by Dr. A. Hill–Rehfeld (Georg-August-University; Göttingen, Germany). The following mouse monoclonal antibodies were purchased and used in this study: ED2 and OX6 (SEROTEC; Oxford, UK), and the anti-GFP antibody (Roche Diagnostics; Mannheim, Germany).

cDNAs and Probes
The cDNA for rat CDMPR was cloned into the Not I site of Bluescript II SK+ (Stratagene; La Jolla, CA) as previously described (Kanamori et al. 1998 Down). A Pst I fragment, containing the 5' non-translated region, the entire coding region (834 bp), and a portion of the 3'-non-translated region (411 bp) was subcloned into Bluescript II SK+ to prepare the probe for ISH. The fusion protein CDMPR-GFP, which contains a variant of green fluorescent protein (GFP), GFP-S65T, at the C-terminus of CDMPR, was constructed in pcDNA3 vector (Invitrogen; Carlsbad, CA) by a PCR-based method. A 879-bp fragment of rat CIMPR cDNA, containing a portion of the luminal domain (174 bp), the transmembrane and cytoplasmic domains (567 bp), and a portion of 3' non-translated region, was amplified by RT-PCR from the total RNA of adult rat pituitary using the following oligonucleotides: upstream primer, ATCGGATCCATCTTCTTCCACTGTGACCC; downstream primer, ATCGAATTCCCCCATTAC-AGAAACTTCCC. The fragment was cloned into Bluescript II SK+ vector at the BamHI-EcoRI restriction site. The PCR fragment was verified by sequencing. Rat cathepsin L cDNA was kindly provided by Dr. K. Ishidoh (Ishidoh et al. 1987 Down). Its EcoRI-BamHI fragment (856 bp) was subcloned into Bluescript II SK+ vector.

Immunofluorescence Microscopy
The liver sections were treated with methanol at room temperature (RT) for 15 min and then incubated with 2% normal goat serum at RT for 20 min. They were then incubated with the following primary antibodies at 4C overnight: anti-CIMPR (1.9 µg/ml), anti-CDMPR (1 µg/ml), MSCI-III-7b (1:1000), ED2 (1:500), and OX6 (1:200). Further incubation was performed with FITC-conjugated goat anti-rabbit IgG (1:1000; Seikagaku Kogyo, Tokyo, Japan) or Texas Red-conjugated goat anti-mouse IgG (1:1000; Biomeda; Foster City, CA) at RT for 1 hr. For double immunofluorescence, the sections were immunolabeled first for ED2 or OX6 and then for CIMPR or CDMPR, as described above. After each step, sections were rinsed with 0.01 M phosphate buffered 0.5 M saline (pH 7.2), containing 0.1% Tween-20 (Sigma Chemical; St Louis, MO). For control experiments, sections were incubated either with a non-immunized rabbit serum diluted to 1:1000 or with a dilution buffer, followed by incubation with FITC-conjugated goat anti-rabbit IgG or Texas Red-conjugated goat anti-mouse IgG. For the cultured cells, CDMPR-GFP was transiently expressed in HeLa cells by transfection using the calcium–phosphate method as described previously (Alconada et al. 1996 Down). After expression for 24 hr, the cells were fixed with 3% paraformaldehyde/PBS at RT for 15 min, washed with PBS, and incubated with 10% normal goat serum/PBS. They were then labeled with rabbit anti-CDMPR and mouse anti-GFP antibodies at RT for 30 min, followed by incubation with FITC-conjugated goat anti-mouse IgG and Texas Red-conjugated goat anti-rabbit IgG at RT for 30 min. The immunofluorescence signal was viewed with a confocal laser microscope, LSM-GB200 (Olympus; Tokyo, Japan) or LSM510 (Carl Zeiss; Jena, Germany).

In Situ Hybridization
Bluescript II SK+ plasmids encoding each cDNA were linearized by digesting at convenient restriction sites on either side of the inserts. Digoxigenin (DIG)-labeled cRNA probes were then synthesized using an RNA labeling kit (Roche Diagnostics; Mannheim, Germany) according to the manufacturer's recommended protocol.

The liver sections were prehybridized in a hybridization buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 600 mM NaCl, 0.25% SDS, 50% deionized formamide, 10% dextran sulfate, 20 µg/µl tRNA from E. coli, 1 x Denhardt's solution) at 50C for 1 hr, and then hybridized with DIG-labeled probes in the same buffer at 50C for 20 hr. After washing with 50% formamide in 2 x SSC at 50C for 30 min, the sections were treated with 1 µg/ml ribonuclease A at 37C for 30 min. They were then washed once with 2 x SSC at 50C for 20 min and twice with 0.2 x SSC at 50C for 20 min. The signal was detected using a DIG Nucleic Acid Detection Kit (Roche Diagnostics).

Immunoblot Analysis
The rat liver tissue was homogenized with a cell lysis buffer solution (0.05 M Tris-HCl, pH 7.5, 0.15 M NaCl, 1% NP-40, 0.5% deoxycholate, 1 mM EDTA) containing a protease inhibitor cocktail (Roche Diagnostics). After centrifugation at 15,000 x g for 15 min, the supernatant was subjected to 10% SDS-PAGE under non-reduced conditions and the proteins were then transferred onto a PVDF membrane (Immobilon; Millipore, Bedford, MA). The blots were immunolabeled with anti-CIMPR or anti-CDMPR antibody, followed by HRP-conjugated anti-rabbit IgG. The signals were detected using ECL reagents (Amersham Pharmacia Biotech).

Immunoprecipitation
HeLa cells transiently expressing CDMPR-GFP and control cells were incubated with methionine-free DMEM (Life Technologies; Rockville, MD) containing 10% dialyzed FBS for 30 min, followed by an incubation with 10 mBq/ml of Redivue PRO-MIX (Amersham Pharmacia Biotech) in the same medium overnight. After washing three times with PBS, the cells were lysed with cell lysis buffer that contained a protease inhibitor cocktail. The resulting lysates were precleared with protein A–Sepharose CL4B (Amersham Pharmacia Biotech) for 1 hr at 4C and centrifuged for 15 min. The supernatant was incubated, first with anti-CDMPR or anti-GFP antibody overnight at 4C and then with protein A–Sepharose CL4B for 1 hr at 4C. After washing the Sepharose, the immune complexes in the SDS gel sampling buffer was boiled for 5 min, and then electrophoresed on a 10% SDS-polyacrylamide gel. The gel was fluorographed and imaged using BAS2000 (Fuji Film; Tokyo, Japan).


*   Results
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Characterization of the Antibodies Used in This Study
The specificity of anti-rat CIMPR antibody has previously been demonstrated by immunoprecipitation and immunofluorescence microscopy (Waguri et al. 1995 Down; Muno et al. 1993 Down). By immunoblotting analysis of liver extracts, the antibody was found to recognize a single band for CIMPR at ~300 kD under non-reduced conditions (Fig 1A). The reduced form of CIMPR was not recognized by this antibody (data not shown). In contrast, anti-CDMPR recognized neither the reduced nor the non-reduced form of CDMPR in our immunoblotting system. To further characterize this antibody, HeLa cells transiently expressing the CDMPR-GFP fusion protein were analyzed by immunoprecipitation. As shown in Fig 1B, the antibody recognized both the endogenous CDMPR (~46 kD) and the transiently expressed CDMPR-GFP (two bands around ~70 kD). The lower sharp band corresponding to CDMPR-GFP probably represents the non-palmitoylated form, as has been reported previously (Schweizer et al. 1996 Down). The specificity of the antibody was also confirmed by immunofluorescence microscopy (Fig 1C); the cells expressing CDMPR-GFP showed a more intense signal for the antibody than the non-expressing cells (Fig 1C; anti-CDMPR), and the GFP signal was completely overlapped with the immunofluorescence signal, which was stained with anti-CDMPR, especially in the perinuclear Golgi region (Fig 1C; merge). We therefore conclude that the antibodies used in this study tend to recognize the folded forms of MPRs and are applicable to immunofluorescence microscopy.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Characterization of anti-CIMPR and anti-CDMPR antibodies. (A) Immunoblot analysis of rat liver extracts using anti-CIMPR and anti-CDMPR antibodies. (B) Immunoprecipitation using anti-CDMPR in cell lysates from HeLa cells with (+) or without (-) the expression of the CDMPR-GFP fusion protein. Protein bands corresponding to CDMPR-GFP and the endogenous CDMPR are indicated. (C) Immunofluorescence microscopy using anti-CDMPR in HeLa cells transiently expressing CDMPR-GFP. The first antibody was detected with Alexa594-conjugated goat anti-rabbit (anti-CDMPR). A merged image (merge) and a phase contrast image (PC) are shown. Bar = 50 µm.

Distribution of the Two MPRs in the Rat Liver
As shown in Fig 2A and Fig 2C, a strong granular immunofluorescence signal for CIMPR was detected in hepatocytes, whereas the signal was faint in sinusoidal cells. A weak but distinct signal was also detected on the cell surface of hepatocytes. In the acinus, the intensity was higher in perivenous than in periportal hepatocytes (Fig 2A). Positive staining for CIMPR was also detected in interstitial cells and in the epithelial cells of interlobular bile ducts, which are located in the portal triad, although this intensity was lower than that found in hepatocytes (Fig 2E). Granular staining for CDMPR was detected in both hepatocytes and sinusoidal cells. The latter were much more intensely immunoreactive than the former (Fig 2B and Fig 2D). No clear-cut difference in immunofluorescence intensity was detected in hepatocytes with respect to their location within the acinus (Fig 2B). In the case of Glisson's capsule, a positive signal for CDMPR was detected in the epithelial cells of interlobular bile ducts and the intensity was higher than that in the hepatocytes. Some interstitial cells, including fibroblast-like cells, also showed distinct signals for CDMPR (Fig 2F and Fig 5C). The same staining patterns were obtained when the antibody MSCI-III-7b, which recognizes the entire cytoplasmic domain of CDMPR, was used (data not shown).



View larger version (120K):
[in this window]
[in a new window]
 
Figure 2. Distribution of two MPRs in rat liver tissue. Immunofluorescence signal for CIMPR (A,C,E) and CDMPR (B,D,F) are demonstrated in the liver acinus (A,B), hepatic cords and sinusoids (C,D), and the portal triad (E,F). The same portions from serial sections are shown in A and B and in E and F. p, portal triad; v, central vein; ia, interlobular hepatic artery; iv, interlobular hepatic vein; ib, interlobular bile duct. Bars = 50 µm.



View larger version (125K):
[in this window]
[in a new window]
 
Figure 3. ISH of CIMPR (A), CDMPR (B), and cathepsin L (C) in liver sections. Positive signal for CIMPR is detected mainly in hepatocytes, while those for CDMPR and cathepsin L are clearly visible in Kupffer cells (arrowheads). Bars = 100 µm.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 4. Immunofluorescence signals for CIMPR and CDMPR in Kupffer cells. Liver sections were double-labeled with ED2 (B,D) and CIMPR (A) or CDMPR (C). Arrowheads indicate ED2-positive Kupffer cells. Bars= 20 µm.



View larger version (62K):
[in this window]
[in a new window]
 
Figure 5. Immunofluorescence signals for CIMPR and CDMPR in antigen-presenting cells. Liver sections were double-labeled with OX6 (B,D) and CIMPR (A) or CDMPR (C). Arrowheads indicate OX6-positive antigen-presenting cells. Arrows indicate fibroblast-like cells positive for CDMPR. Bars = 20 µm.

The preferential localization of CIMPR and CDMPR in hepatocytes and sinusoidal cells was also confirmed by ISH. As shown in Fig 3, the majority of the CIMPR transcript was detected in hepatocytes (Fig 3A), whereas the expression level of CDMPR mRNA was higher in sinusoidal cells than in hepatocytes (Fig 3B). The distribution pattern of the CDMPR transcript was similar to that of cathepsin L (Fig 3C), which has been shown to exist at higher levels in Kupffer cells than in hepatocytes (Watanabe et al. 1989 Down).

Identification of CDMPR-positive Cells
We next attempted to identify the CDMPR-positive cells in the sinusoid and Glisson's capsule using the MAbs, ED2 and OX6, which are known to serve as markers for Kupffer cells (Dijkstra and Damoiseaux 1993 Down) and antigen-presenting cells (Prickett et al. 1988 Down; Steinman 1991 Down; Matsuno et al. 1995 Down), respectively. Double immunofluorescence microscopic observations showed that CDMPR-positive cells within the sinusoid were also ED2-positive, indicating that these cells are Kupffer cells (Fig 4C and Fig 4D). ED2-positive cells showed almost no signal for CIMPR (Fig 4A and Fig 4B). In the Glisson's capsule, immunoreactivity for CDMPR was detected in OX6-positive cells, although its intensity was lower than those in fibroblast-like cells (Fig 5C and Fig 5D). CIMPR immunoreactivity was weak or faint in the OX6-positive cells (Fig 5A and Fig 5B).


*   Discussion
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

The present study demonstrates that CI- and CDMPR are expressed at different levels and locations in the rat liver. The former was distributed mainly in hepatocytes, whereas the latter was localized in non-hepatocytic cells, such as Kupffer cells and antigen-presenting cells (APCs).

In a previous study, Matzner et al. 1992 Down suggested, on the basis of ISH experiments, that unknown specific functions are operative between the two MPRs during mouse embryogenesis, in that complementary expression patterns were observed. This notion is essentially consistent with the present results. By comparing the distribution of two MPRs in the rat liver, their expression patterns were found to be rather tissue-selective. CDMPR was intensely expressed in non-hepatocyte cells, such as Kupffer cells, APCs, and the epithelial cells of interlobular bile ducts, whereas CIMPR was expressed mainly in hepatocytes. This contrast suggests that CDMPR plays important roles in lysosomal enzyme trafficking in non-hepatocyte cells of the liver. Promoter analyses of human and mouse CDMPR genes have shown that they contain CpG islands and lack a TATA box, suggesting that CDMPR is expressed constitutively as a housekeeping gene (Klier et al. 1991 Down; Ludwig et al. 1992 Down), whereas the expression of CIMPR is regulated by several transcription factors (Liu et al. 1995 Down). Such gene characteristics of CDMPR may correspond with its rather broad expression in rat liver tissue. However, the higher expression of CDMPR observed in Kupffer cells suggests that it is not merely a housekeeping gene but rather that its expression is regulated by unknown mechanisms in the liver tissue in a cell-specific manner.

It has been shown that the cathepsin L family of proteinases, such as cathepsins K and S, play important roles in bone absorption and antigen processing in osteoclasts and APCs, respectively (Saftig et al. 1998 Down; Nakagawa et al. 1999 Down; Shi et al. 1999 Down). It has also been shown that cathepsin L is localized in Kupffer cells of the liver and macrophages in the lung and intestine (Ii et al. 1985 Down; Watanabe et al. 1989 Down; Furuhashi et al. 1991 Down; Ishii et al. 1991 Down). The present results, using ISH, confirmed that cathepsin L mRNA was specifically detected in Kupffer cells. Kupffer cells and APCs are involved in the defense and immune systems in the liver and therefore require the expression of the cathepsin L family of proteinases. As stated above, CDMPR was preferentially expressed in these mononuclear cell-derived cells in liver tissue. This result is consistent with previous biochemical studies in which mouse cathepsin L, also known as MEP (major excreted protein), showed a low binding affinity for CIMPR (Dong et al. 1989 Down; Dong and Sahagian 1990 Down; Lazzarino and Gabel 1990 Down). Therefore, it is likely that CDMPR is mainly involved in the sorting of cathepsin L in these cells. Until recently, no remarkable histological and functional disorders have been shown in CDMPR-deficient mice, except for a partial misrouting of lysosomal enzymes (Koster et al. 1993 Down; Ovitt et al. 1993 Down), suggesting that the role of CDMPR in Kupffer cells and APCs may be compensated by CIMPR. More precise studies of the morphological and functional aspects of these cells will be required using deficient mice.

There have been several studies concerning interactions of both MPRs with M6P. In equilibrium dialysis binding studies, Tong et al. 1989 Down and Tong and Kornfeld 1989 Down have revealed that CIMPR contains two binding sites for M6P per monomer, whereas CDMPR binds one molecule of M6P per monomeric subunit. Therefore, it was assumed that differences in the phosphorylation state of oligosaccharides, which are attached to the lysosomal enzymes, determine the preferential binding of lysosomal enzymes to either MPRs. This hypothesis was tested using MPRs-deficient fibroblasts re-expressing CI- or CDMPR. By characterizing phosphorylated oligosaccharides of lysosomal enzymes secreted from these fibroblasts, Munier-Lehmann et al. 1996a Down have shown that CIMPR preferentially binds enzymes that have oligosaccharides with two phosphomonoesters, whereas CDMPR tends to bind enzymes that have multiple oligosaccharides with one phosphomonoester. Moreover, they have shown that the two MPRs appear to transport different isoforms of cathepsin D, which is known to be sorted more efficiently by CIMPR than by CDMPR (Ludwig et al. 1994 Down; Pohlmann et al. 1995 Down). However, another study that examined the oligosaccharides of secreted cathepsin D has demonstrated that little difference is detected in the phosphorylation state of the secreted enzyme between the fibroblasts that express CI- or CDMPR and, furthermore, that oligosaccharides with two phosphomonoesters represent the major oligosaccharide species (Dittmer et al. 1997 Down). Although the discrepancy between these two results has not been explained, Dittmer et al. 1997 Down have suggested that other parameters, including the structure of the underlying oligosaccharides, the position of the phosphorylated mannose residues within the oligosaccharides, and the polypeptide backbone, would determine the affinity of the enzyme for the two MPRs. When we consider these notions, our present results could indicate that the difference in affinity of the two MPRs for each lysosomal enzyme contributes to the different distribution patterns of the MPRs, because lysosomal enzymes also show heterogeneous distribution patterns depending on enzymes, cells, and tissues (Uchiyama et al. 1994 Down). However, more information concerning differences in the oligosaccharide modification and the phosphorylation state of lysosomal enzymes for several types of cells and tissues will be needed.

As stated above, CIMPR is mainly expressed in hepatocytes, suggesting the importance of this receptor in the cells. In addition to its sorting function of M6P-containing lysosomal enzymes in the TGN, CIMPR has also been shown to bind several ligands on the cell surface. It is involved in the downregulation of the extracellular IGFII levels (Ludwig et al. 1995 Down) and in the activation of TGF-ß (Dennis and Rifkin 1991 Down). Moreover, retinoic acid has also been shown to bind CIMPR, leading to the redistribution of the receptor (Kang et al. 1997 Down, Kang et al. 1998 Down). Therefore, hepatocytes are involved in the quantitative regulation of biologically active factors via the expression of CIMPR. In addition to these physiological functions of CIMPR in hepatocytes, it is also known to be a tumor suppressor molecule and, in fact, the loss of the CIMPR gene is frequently found in hepatocellular carcinoma (Piao et al. 1997 Down; Yamada et al. 1997 Down).

The distribution of CIMPR within the liver acinus is also intriguing. Its expression was high in the perivenous region compared to the periportal region. This staining pattern is in agreement with our previous results, in which the same distribution patterns of lysosomal cysteine proteinases, cathepsins B and H, in the rat liver acinus were demonstrated (Waguri et al. 1990 Down). These lines of evidence suggest that the predominant proteolytic activity in lysosomes is also ensured by the higher expression of CIMPR in perivenous hepatocytes and, furthermore, that cathepsins B and H may be transported mainly by CIMPR, at least in the hepatocytes of rat liver.

Collectively, the present data, which show that the expression of CIMPR was predominant in hepatocytes whereas that of CDMPR was prominent in Kupffer cells and APCs, suggest that the two MPRs possess different functions in the rat liver.


*   Acknowledgments

Supported by a grant from The Japan Ministry of Education, Science and Culture.

We are grateful to Dr A. Hill–Rehfeld (Georg-August-University, Göttingen), and Dr Ishidoh (Juntendo University, Japan) for providing MSCI-III-7b and cDNA for cathepsin L, respectively. We also thank Dr K. Matsuno (Kumamoto University School of Medicine, Kumamoto) for his valuable suggestions concerning dendritic cells in the rat liver.

Received for publication March 7, 2001; accepted June 13, 2001.


*   Literature Cited
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Alconada A, Bauer U, Hoflack B (1996) A tyrosine-based motif and a casein kinase II phosphorylation site regulate the intracellular trafficking of the varicella-zoster virus glycoprotein I, a protein localized in the trans-Golgi network. EMBO J 15:6096-6110[Medline]

Dahms NM (1996) Insulin-like growth factor II/cation-independent mannose 6-phosphate receptor and lysosomal enzyme recognition. Biochem Soc Trans 24:136-141[Medline]

Dennis PA, Rifkin DB (1991) Cellular activation of latent transforming growth factor ß requires binding to the cation-independent mannose 6-phosphate/insulin-like growth factor type II receptor. Proc Natl Acad Sci USA 88:580-584[Abstract/Free Full Text]

Dijkstra CD, Damoiseaux JGMC (1993) Macrophage heterogeneity established by immunocytochemistry. Prog Histochem Immunohistochem 27:1-65

Dittmer F, Pohlmann R, von Figura K (1997) The phosphorylation pattern of oligosaccharides in secreted procathepsin D is glycosylation site-specific and independent of the expression of mannose 6-phosphate receptors. J Biol Chem 272:852-858[Abstract/Free Full Text]

Dong J, Prence EM, Sahagian GG (1989) Mechanism for selective secretion of a lysosomal protease by transformed mouse fibroblasts. J Biol Chem 264:7377-7383[Abstract/Free Full Text]

Dong J, Sahagian GG (1990) Basis for low affinity binding of a lysosomal cysteine protease to the cation-independent mannose 6-phosphate receptor. J Biol Chem 265:4210-4217[Abstract/Free Full Text]

Furuhashi M, Nakahara A, Fukutomi H, Kominami E, Grube D, Uchiyama Y (1991) Immunocytochemical localization of cathepsins B, H, and L in the rat gastro-duodenal mucosa. Histochemistry 95:231-239[Medline]

Ii K, Hizawa E, Kominami E, Bando Y, Katunuma N (1985) Different immunolocalizations of cathepsins B, H, and L in the liver. J Histochem Cytochem 33:1173-1175[Abstract]

Ishii Y, Hashizume Y, Watanabe T, Satoshi W, Sato N, Yamamoto M, Hasegawa S, Kominami E, Uchiyama Y (1991) Cysteine proteinases in bronchoalveolar epithelial cells and lavage fluid of rat lung. J Histochem Cytochem 39:461-468[Abstract]

Ishidoh K, Towatari T, Imajoh S, Kawasaki H, Kominami E, Katunuma N, Suzuki K (1987) Molecular cloning and sequencing of cDNA for rat cathepsin L. FEBS Lett 223:69-73[Medline]

Kanamori S, Waguri S, Shibata M, Isahara K, Ohsawa Y, Konishi A, Kametaka S, Watanabe T, Ebisu S, Kominami E, Uchiyama Y (1998) Overexpression of cation-dependent mannose 6-phosphate receptor prevents cell death induced by serum deprivation in PC12 cells. Biochem Biophys Res Commun 251:204-208[Medline]

Kang JX, Bell J, Leaf A, Beard RL, Chandraratna RA (1998) Retinoic acid alters the intracellular trafficking of the mannose-6-phosphate/insulin-like growth factor II receptor and lysosomal enzymes. Proc Natl Acad Sci USA 95:13687-13691[Abstract/Free Full Text]

Kang JX, Li Y, Leaf A (1997) Mannose-6-phosphate/insulin-like growth factor-II receptor is a receptor for retinoic acid. Proc Natl Acad Sci USA 94:13671-13676[Abstract/Free Full Text]

Kasper D, Dittmer F, von Figura K, Pohlmann R (1996) Neither type of mannose 6-phosphate receptor is sufficient for targeting of lysosomal enzymes along intracellular routes. J Cell Biol 134:615-623[Abstract/Free Full Text]

Klier HJ, von Figura K, Pohlmann R (1991) Isolation and analysis of the human 46-kDa mannose 6-phosphate receptor gene. Eur J Biochem 197:23-28[Medline]

Kornfeld S, Mellman I (1989) The biogenesis of lysosomes. Annu Rev Cell Biol 5:483-525

Köster A, Saftig P, Matzner U, von Figura K, Peter C, Pohlmann R (1993) Targeted disruption of the Mr 46000 mannose 6-phosphate receptor gene in mice results in misrouting of lysosomal proteins. EMBO J 12:5219-5223[Medline]

Lazzarino D, Gabel CA (1990) Protein determinants impair recognition of procathepsin L phosphorylated oligosaccharides by the cation-independent mannose 6-phosphate receptor. J Biol Chem 265:11864-11871[Abstract/Free Full Text]

Liu Z, Mittanck DW, Kim S, Rotwein P (1995) Control of insulin-like growth factor-II/mannose 6-phosphate receptor gene transcription by proximal promoter elements. Mol Endocrinol 9:1477-1487[Abstract/Free Full Text]

Ludwig T, Le Borgne R, Hoflack B (1995) Roles for mannose 6-phosphate receptors in lysosomal enzyme sorting, IGF-II binding and clathrin-coat assembly. Trends Cell Biol 5:202-206[Medline]

Ludwig T, Munier LH, Bauer U, Hollinshead M, Ovitt C, Lobel P, Hoflack B (1994) Differential sorting of lysosomal enzymes in mannose 6-phosphate receptor-deficient fibroblasts. EMBO J 13:3430-3437[Medline]

Ludwig T, Ruther U, Metzger R, Copeland NG, Jenkins NA, Lobel P, Hoflack B (1992) Gene and pseudogene of the mouse cation-dependent mannose 6-phosphate receptor. Genomic organization, expression, and chromosomal localization. J Biol Chem 267:12211-12219[Abstract/Free Full Text]

Matsuno K, Kudo S, Ezaki T, Miyakawa K (1995) Isolation of dendritic cells in the rat liver lymph. Transplantation 60:765-768[Medline]

Matzner U, von Figura K, Pohlmann R (1992) Expression of the two mannose 6-phosphate receptors is spatially and temporally different during mouse embryogenesis. Development 114:965-972[Abstract]

Munier-Lehmann H, Mauxion F, Bauer U, Lobel P, Hoflack B (1996a) Re-expression of the mannose 6-phosphate receptors in receptor-deficient fibroblasts—complementary function of the two mannose 6-phosphate receptors in lysosomal enzyme targeting. J Biol Chem 271:15166-15174[Abstract/Free Full Text]

Munier–Lehmann H, Mauxion F, Hoflack B (1996b) Function of the two mannose 6-phosphate receptors in lysosomal enzyme transport. Biochem Soc Trans 24:133-136[Medline]

Muno D, Ishidoh K, Ueno T, Kominami E (1993) Processing and transport of the precursor of cathepsin C during its transfer into lysosomes. Arch Biochem Biophys 306:103-110[Medline]

Nadimpalli SK, Schmidt B, von Figura K, Hille A (1991) Antibodies against the cytoplasmic tail can differentiate between the quaternary forms of the Mr 46,000 mannose 6-phosphate receptor. FEBS Lett 280:61-64[Medline]

Nakagawa TY, Brissette WH, Lira PD, Griffiths RJ, Petrushova N, Stock J, McNeish JD, Eastman SE, Howard ED, Clarke SR, Rosloniec EF, Elliott EA, Rudensky AY (1999) Impaired invariant chain degradation and antigen presentation and diminished collagen-induced arthritis in cathepsin S null mice. Immunity 10:207-217[Medline]

Ocrant I, Valentino KL, Hoffman AR, Hintz RL, Wilson DM, Rosenfeld RG (1989) Structural characterization and immunohistochemical localization of receptors for insulin-like growth factor II in the rat pituitary gland. Neuroendocrinology 49:248-254[Medline]

Ovitt CE, Bauer U, Hollinshead M, Remmler J, Lobel P, Rüther U, Hoflack B (1993) Targeted disruption of the mouse cation-dependent mannose 6-phosphate receptor results in partial missorting of multiple lysosomal enzymes. EMBO J 12:5225-5235[Medline]

Piao Z, Choi Y, Park C, Lee WJ, Park JH, Kim H (1997) Deletion of the M6P/IGF2r gene in primary hepatocellular carcinoma. Cancer Lett 120:39-43[Medline]

Pohlmann R, Wendland M, Boeker C, von Figura K (1995) The two mannose 6-phosphate receptors transport distinct complements of lysosomal proteins. J Biol Chem 270:27311-27318[Abstract/Free Full Text]

Prickett TCR, Mckenzie JL, Hart DNJ (1988) Characterization of interstitial dendritic cells in human liver. Transplantation 46:754-761[Medline]

Saftig P, Hunziker E, Wehmeyer O, Jones S, Boyde A, Rommerskirch W, Moritz JD, Schu P, von Figura K (1998) Impaired osteoclastic bone resorption leads to osteopetrosis in cathepsin-K-deficient mice. Proc Natl Acad Sci USA 95:13453-13458[Abstract/Free Full Text]

Schweizer A, Kornfeld S, Rohrer J (1996) Cysteine34 of the cytoplasmic tail of the cation-dependent mannose 6-phosphate receptor is reversibly palmitoylated and required for normal trafficking and lysosomal enzyme sorting. J Cell Biol 132:577-584[Abstract/Free Full Text]

Shi GP, Villadangos JA, Dranoff G, Small C, Gu L, Haley KJ, Riese R, Ploegh HL, Chapman HZ (1999) Cathepsin S required for normal MHC class II peptide loading and germinal center development. Immunity 10:197-206[Medline]

Steinman RM (1991) The dendritic cell system and its role in immunogenicity. Annu Rev Immunol 9:271-296[Medline]

Tong PY, Gregory W, Kornfeld S (1989) Ligand interactions of the cation-independent mannose 6-phosphate receptor. J Biol Chem 264:7962-7969[Abstract/Free Full Text]

Tong PY, Kornfeld S (1989) Ligand interactions of the cation-dependent mannose 6-phosphate receptor. J Biol Chem 264:7970-7975[Abstract/Free Full Text]

Uchiyama Y, Waguri S, Sato N, Watanabe T, Ishidoh K, Kominami E (1994) Cell and tissue distribution of lysosomal cysteine proteinases, cathepsins B, H, and L, and their biological roles. Acta Histochem Cytochem 27:287-308

Valentino KL, Ocrant I, Rosenfeld RG (1990) Developmental expression of insulin-like growth factor-II receptor immunoreactivity in the rat central nervous system. Endocrinology 126:914-920[Abstract/Free Full Text]

Valentino KL, Pham H, Ocrant I, Rosenfeld RG (1988) Distribution of insulin-like growth factor II receptor immunoreactivity in rat tissues. Endocrinology 122:2753-2763[Abstract/Free Full Text]

von Figura K, Hasilik A (1986) Lysosomal enzymes and their receptors. Annu Rev Biochem 55:167-193[Medline]

Waguri S, Sato N, Watanabe T, Ishidoh K, Kominami E, Sato K, Uchiyama Y (1995) Cysteine proteases in GH4C1 cells, a rat pituitary tumor cell line, are secreted by the constitutive and regulated secretory pathways. Eur J Cell Biol 67:308-318[Medline]

Waguri S, Watanabe T, Kominami E, Uchiyama Y (1990) Variations in immunoreactivity of angiotensinogen and cathepsins B and H in rat hepatocytes over 24 hours. Am J Anat 187:175-182[Medline]

Watanabe T, Waguri S, Watanabe M, Ishii Y, Kominami E, Uchiyama Y (1989) Immunocytochemical localization of angiotensinogen and cathepsins B, H, and L in rat hepatocytes, with special reference to degradation of angiotensinogen in lysosomes after colchicine. J Histochem Cytochem 37:1899-1911[Abstract]

Yamada T, De Souza AT, Finkelstein S, Jirtle RL (1997) Loss of the gene encoding mannose 6-phosphate/insulin-like growth factor II receptor is an early event in liver carcinogenesis. Proc Natl Acad Sci USA 94:10351-10355[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Kametaka, M. Shibata, K. Moroe, S. Kanamori, Y. Ohsawa, S. Waguri, P. J. Sims, K. Emoto, M. Umeda, and Y. Uchiyama
Identification of Phospholipid Scramblase 1 as a Novel Interacting Molecule with beta -Secretase (beta -Site Amyloid Precursor Protein (APP) Cleaving Enzyme (BACE))
J. Biol. Chem., April 18, 2003; 278(17): 15239 - 15245.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Waguri, S.
Right arrow Articles by Uchiyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Waguri, S.
Right arrow Articles by Uchiyama, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact