Journal of Histochemistry and Cytochemistry Priciples for Free Access to Science
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, F.-X.
Right arrow Articles by Harrison, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, F.-X.
Right arrow Articles by Harrison, L. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Journal of Histochemistry and Cytochemistry, Vol. 50, 1625-1632, December 2002, Copyright © 2002, The Histochemical Society, Inc.


ARTICLE

Distinct Distribution of Laminin and Its Integrin Receptors in the Pancreas

Fang-Xu Jianga, Gaetano Nasellia, and Leonard C. Harrisona
a Autoimmunity and Transplantation Division, the Walter and Eliza Hall Institute of Medical Research, The Royal Melbourne Hospital, Parkville, Australia

Correspondence to: Leonard C. Harrison, Walter & Eliza Hall Inst. of Medical Research, Royal Melbourne Hospital, Parkville 3050, Victoria, Australia. E-mail: harrison@wehi.edu.au


*   Summary
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Tissue function is regulated by the extracellular microenvironment including cell basement membranes, in which laminins are a major component. Previously, we found that laminin-1 promotes differentiation and survival of pancreatic islet cells. Here we characterize the expression pattern of laminins and their integrin receptors in adult pancreas. Although they are expressed in the basement membrane of acinar cells and duct epithelium, no laminin chains examined were detected extracellularly in the pancreatic islets. In contrast to laminin ß1- and {gamma}1-chains, the {alpha}1-chain, unique to laminin-1, was not detected. Laminin-10 ({alpha}5ß1{gamma}1) was expressed in acinar tissue, whereas laminins-2 ({alpha}2ß1{gamma}1) and -10 were expressed in the blood vessels. The laminin connector molecule, nidogen-1, had a distribution similar to that of laminin ß1 and {gamma}1, whereas fibulin-1 and -2, which compete with nidogen-1, were mostly confined to blood vessels. Integrin subunits {alpha}6 and {alpha}3 were detected in acinar cells and duct epithelial cells, but {alpha}6 was absent in islet cells. Integrin {alpha}6ß4 was detected only in duct cells, {alpha}6ß1 in both acinar and ductal cells, and {alpha}3ß1 in acinar, duct, and islet cells. These findings are a basis for further investigation of the role of extracellular matrix molecules and their receptors in pancreas function.

(J Histochem Cytochem 50:1625–1632, 2002)

Key Words: laminin, nidogen, fibulin, integrin, pancreas


*   Introduction
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

THE PANCREAS is derived from the foregut endoderm and comprises three main elements: exocrine tissue, which produces and secretes digestive enzymes; a duct system that transports the digestive enzymes to the intestinal tract; and endocrine tissue, the islets of Langerhans, which secrete hormones, predominantly insulin, to regulate blood glucose metabolism and homeostasis. Pancreatic development and function, as for other organs, depends on cooperative extracellular signals, both soluble hormones and growth factors and cell-associated insoluble extracellular matrix (ECM) proteins (Lelievre et al. 1996 Down). We have shown that the ECM protein laminin-1 promotes differentiation of fetal pancreatic cells into ß-cells in vitro (Jiang et al. 1999 Down). In the adult, islet cell–ECM interactions are proposed to be required for ß-cell survival and function (Wang et al. 1999 Down), and in adult rat islets laminin-5 is known to enhance insulin secretion in vitro (Bosco et al. 2000 Down). Laminin is the major component (80%) of the basement membrane of epithelial and endothelial cells. It is a heterotrimeric glycoprotein (Mr 850,000) composed of disulfide bonded {alpha} (400 kD)-, ß (210 kD)- and {gamma} (200 kD)-chains (Colognato and Yurchenco 2000 Down; Tunggal et al. 2000 Down). Altogether, 11 laminin chains have been cloned, including {alpha}1–5-, ß1–3-, and {gamma}1–3-chains, and 12 laminin isoforms have been identified (Erickson and Couchman 2000 Down; Tunggal et al. 2000 Down). Laminin connects to collagen IV, another key component of the BM, by a bridging molecule called nidogen-1 (Timpl and Brown 1996 Down; Pujuguet et al. 2000 Down), which competes for binding to laminin with fibulin-1 or -2 (Yurchenco and O'Rear 1994 Down; Timpl and Brown 1996 Down).

Integrins, one type of receptor for laminins, comprise a family of heterodimeric cell adhesion glycoprotein molecules composed of non-covalently bound {alpha} (120–180 kD)- and ß (90–110 kD)-subunits, of which there are 16 and at least 22 isoforms, respectively. In addition to mediating cell–matrix and cell–cell interactions, integrins transduce extracellular signals. All known epithelial integrin receptors for laminins comprise isoforms of {alpha}6-, {alpha}3-, ß1-, and ß4-subunits (Belkin and Stepp 2000 Down), {alpha}3 and {alpha}6 being the only subunits with significant (40%) identity (Hogervorst et al. 1991 Down).

The expression and localization of laminins and integrins in the pancreas are poorly documented, despite the potential importance of these molecules in pancreatic development and function. As a baseline for further investigations, we analyzed the expression of laminins and associated molecules, and of integrins, in adult mouse pancreas.


*   Materials and Methods
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Animals and Tissues
Adult (8–12-week) CBA mice bred under specific pathogen-free conditions were sacrificed by cervical dislocation and their pancreases harvested and snap-frozen in liquid nitrogen.

Primary Antibodies
Primary antibodies available for use for indirect immunofluorescence, immunoblotting, and immunoprecipitation are listed in Table 1.


 
View this table:
[in this window]
[in a new window]
 
Table 1. Primary antibodies

Indirect Immunofluorescence Microscopy
Cryostat sections (8 µm) were air-dried for 40–60 min and fixed in cold (-20C) acetone for 10 min before indirect immunofluorescence staining, or were stored at -80C if not used immediately. Before antibody staining, nonspecific protein binding was blocked by incubation for at least 30 min with warm MT–PBS containing 2% bovine serum albumin or 2% normal rabbit serum. Controls were performed by replacing the first antibody with isotype control antibodies [for monoclonal antibodies (MAbs)] or with pre-immune serum from the appropriate species (for polyclonal antibodies). Tissues were incubated with primary antibodies for 90 min at 25C, followed by three thorough washes with MT–PBS. Fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse or anti-rat immunoglobulins (DAKO; Glostrup, Denmark) were incubated for 30 min at 25C, followed by three thorough washes. Slides were observed and photomicrographed under a Zeis Axiophot fluorescent microscope.

Immunoprecipitation and Immunoblotting
To further characterize integrin expression in islet cells, immunoprecipitation and immunoblotting analysis was undertaken. A ß-cell line, rat insulinoma RIN A12 cells (Gazdar et al. 1980 Down), reported to express several integrin subunits (Kantengwa et al. 1997 Down), was grown in RPMI + 10% FCS almost to confluence, washed with MT–PBS, and collected by scraping. The cell pellet was resuspended in lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 10 mM Na2HPO4 with the protease inhibitors 1 mM PMSF, 1 µg/ml pepstatin A, and 0.15 U/ml aprotinin) and incubated on ice for 15 min. The lysate was centrifuged at 13,000 rpm for 15 min at 4C and the supernatant pre-cleared with protein G–Sepharose beads. The pre-cleared supernatant was mixed with protein G beads that had been pre-bound with anti-{alpha}6 or -{alpha}3 integrin antibodies and rotated at 4C for 2 hr. The beads were washed five times with the lysis buffer, resuspended in reducing SDS sample buffer, and boiled for 3 min. The lysate was electrophoresed in a 10–20% SDS-PAGE gel (Novex; Invitrogen, Carlsbad, CA) and transferred to nitrocellulose membrane. After blocking for 1 hr in 5% milk powder in MT–PBS, the membrane was incubated with anti-ß1 or -ß4 integrin antibodies diluted in 1% milk powder in MT–PBS with 0.05% Tween-20 (PBS-T) for 2 hr at RT, washed five times for 10 min with PBS-T, and then incubated with secondary antibodies diluted in 1% milk powder in PBS-T for 1 hr at RT. After five washes with PBS-T, the immunoblot was developed for 5 min with Lumi-Light Western Blotting Substrate (Roche; Indianapolis, IN) and exposed to Hyperfilm MP (Amersham Pharmacia Biotech; Poole, UK).

RT-PCR Analysis of Laminin RNAs
Total RNA from mouse pancreas or RIN cells was extracted with RNAzol B (Cinna/Biotecx; Houston, TX) and treated with DNase I (Gibco BRL; Gaithersburg, MD). mRNA was reverse-transcribed with Superscript II reverse transcriptase (Gibco BRL) in 1 x transcription buffer containing 0.5 µM oligo (dT)16–18 primer (Gibco BRL) and 400 µM dNTPs. Aliquots of cDNAs were amplified by PCR in 1 x PCR buffer (Roche) containing 200 µM dNTPs, 1 µM of each primer pair, and 1 U Taq polymerase. The primers for laminin {alpha}1 (5' GACCGCCATGCCGATTTAGC 3', 5' GACCGCCGTGTTGTTGATGC 3'), laminin {alpha}5 (5' CCCTGGGGCCTTGAACTTCTCCTACTC 3', 5' GCATTGCGCCGATC-CACCTCAG 3'), laminin ß1 (5' ACCAGACGGGCCTTGCTTGTGAAT 3', 5' AGTTGTGGCCCGTGGTGTAG-TCCTG 3') and for the control "housekeeping" gene ß-actin (5' GTGGGCCGCCCTAGGCACCA 3', 5' CTCTTTGATGTCACGCACGATTTC 3') all yielded PCR products of 530 bp. PCR reactions were performed for 35 cycles (95C, 30 sec; 60C, 30 sec; 72C, 30 sec), and amplified products were separated in 1.5% agarose gels.


*   Results
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Laminin Expression
Laminin, detected with polyclonal rabbit anti-laminin antibodies, was expressed in the basement membrane (BM) of several tissues in the pancreas. In the basal lamina of exocrine cells, intra-islet capillary plexuses, duct epithelia, and smooth muscle of arteries and veins (Fig 1A–1C). This antibody, generated to murine Engelbreth–Holm–Swarm tumor BM, identifies {alpha}1-, ß1-, and {gamma}1-chains (Ferletta and Ekblom 1999 Down) and detects all laminin isoforms, except for laminin-5 ({alpha}3ß3{gamma}2), reported to be preferentially expressed in BM of squamous and transitional epithelia (Burgeson et al. 1994 Down).



View larger version (111K):
[in this window]
[in a new window]
 
Figure 1. Distribution of laminin chains in the adult mouse pancreas. Laminin, detected by rabbit anti-mouse laminin IgG and fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit immunoglobulins (Ig), was extensively distributed in the ECM, in arteries, and in veins (A), the BM of the acinar cells (B), and in the islets (C). Laminin ß1-chain, detected by an MAb rat anti-mouse laminin ß1 IgG1k and FITC-conjugated rabbit anti-rat Ig, had a similar pattern to laminin in arteries (D; higher magnification E) and islets (F). Laminin {gamma}1-chain, detected by an MAb rat anti-mouse laminin {gamma}1 IgG2a and FITC-conjugated rabbit anti-rat Ig, had identical distribution to laminin ß1 (G–H). Laminin {gamma}2, detected by an MAb mouse anti-human laminin {gamma}2 IgG1 and FITC-conjugated rabbit anti-mouse Ig, was expressed in interlobular (I) and intralobular (J) blood vessels. Laminin {alpha}5-chain, detected by MAb rat anti-laminin {alpha}5 antibody and FITC-conjugated rabbit anti-rat Ig, was expressed in the interlobular (K and L) and intralobular (M and N) blood vessels and in intra-islet capillaries (O).

Laminin chains detected with specific monoclonal antibodies (MAbs) had a unique distribution pattern in the pancreas (Table 2). Laminin {alpha}1, specific for laminin-1 ({alpha}1ß1{gamma}1), was not detected in the adult mouse pancreas, consistent with our RT-PCR analysis (see below) and with previous reports (Falk et al. 1999 Down; Virtanen et al. 2000 Down). The expression patterns of laminins ß1 and {gamma}1 were the same as those revealed with the rabbit anti-laminin antibody (Fig 1D–1H). Laminin {alpha}2, a component of laminin-2 ({alpha}2ß1{gamma}1), laminin-4 ({alpha}2ß2{gamma}1), and laminin-12 ({alpha}2ß1{gamma}3), and laminin {gamma}2, which is present in laminin-5, were detected only in the basal lamina of smooth muscle cells in arteries and veins (Fig 1I and Fig 1J). Laminin {alpha}5, a component of laminin-10 ({alpha}5ß1{gamma}1) and laminin-11 ({alpha}5ß2{gamma}1), was richly distributed in the BM of endothelia, in the basal lamina of smooth muscle cells in arteries and veins and of myoid cells in interlobular ducts, consistent with other reports (Sorokin et al. 1997 Down; Maatta et al. 2001 Down). It was spirally distributed along arteries, being less orderly in the veins and irregular in ducts (interlobular and intralobular). Laminin {alpha}5 also appeared in the peripheral islet and penetrated into the islets along intra-islet capillaries (Fig 1K–1O). The pattern of nidogen-1 expression (Fig 2A–2D) was the same as that of laminins ß1 and {gamma}1. The distributions of fibulin-1 and -2 were similar (Fig 2E–2H), resembling that of laminin {alpha}5.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 2. Distribution of nidogen and fibulin in adult mouse pancreas. Nidogen, detected by rabbit anti-mouse nidogen Ig and FITC-conjugated goat anti-rabbit Ig, was expressed in interlobular blood vessels (A; higher magnification in B), islets (C; higher magnification in D). Fibulin (E–H), detected by rabbit anti-mouse fibulin Ig and FITC-conjugated goat anti-rabbit Ig, was expressed in various orders of blood vessels.


 
View this table:
[in this window]
[in a new window]
 
Table 2. Summary: distribution of laminin chains in adult mouse pancreas

To provide additional evidence that the laminin {alpha}1-chain is not expressed in adult pancreas, RT-PCR analysis of mRNAs was performed. Consistent with the immunofluorescence studies, laminin {alpha}1 transcripts were barely detectable, whereas those for laminin ß1 were readily detected (Fig 3). mRNA for laminin {alpha}5 was detected only in E17.5 pancreas and RIN cells (Fig 3).



View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. RT-PCR analysis of laminin chains in adult mouse pancreas. mRNAs were incubated with (+) or without (-) reverse transcriptase and subjected to PCR with specific primers as described in Materials and Methods.

Integrin Expression
Integrin subunits exhibited a striking cell-specific expression pattern (Table 3). Integrin {alpha}6-subunit was strongly expressed basally in acinar cells, where it interacts with laminin, but was not detected in interlobular arteries or in veins and ducts. It also appeared to be expressed in epithelial cells of various orders of pancreatic ducts from interlobular to intercalated ducts, and in endothelial cells (Fig 4A–4C). However, islet cells clearly did not express this integrin subunit (Fig 4D). Integrin {alpha}3 was expressed weakly in acinar cells but strongly in arteries, veins, and intralobular ducts (Fig 4K and Fig 4L). Integrin ß1 was expressed in various compartments of the pancreas, with strong expression in interlobular duct epithelial cells and endothelial cells (Fig 4E and Fig 4F), and in islet cells (Fig 4G), but with weak expression in acinar cells. ß4 appeared to be expressed in epithelial cells in various orders of the duct system (Fig 4H and Fig 4I), including within islets (Fig 4J) but not in acinar cells.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 4. Distribution of integrin subunits in the adult mouse pancreas. Integrin {alpha}6-subunit, detected by rat anti-mouse integrin {alpha}6 MAb IgG2a and FITC-conjugated rabbit anti-rat Ig, was expressed in acinar cells and intercalated (A), intralobular (B), and interlobular duct epithelial cells (C), but not in islet cells (D). Integrin ß1 (F,G), ß4 (H–J), and {alpha}3 (K,L) subunits were detected by monoclonal mouse anti-chicken integrin IgG1 (for ß1), mouse anti-human integrin IgG1 (for ß4 and {alpha}3), and FITC-conjugated rabbit anti-mouse Ig. The integrin ß1-subunit was detected in the interlobular (E) and intralobular duct epithelium and weakly in the acinar cells (F) and with various densities in islet cells (G). The integrin ß4-subunit was detected in the epithelial cells of intralobular (H) and intercalated ducts (I) and in islets (J). The integrin {alpha}3 subunit was expressed in the endothelium and smooth muscle cells of the blood vessels (K), in intralobular duct cells and weakly in acinar cells (L).


 
View this table:
[in this window]
[in a new window]
 
Table 3. Summary: distribution of integrins in adult mouse pancreas

To provide additional evidence that the absence of the integrin {alpha}6-subunit in mouse islet cells was not species-specific, a rat ß-cell line, RIN-A12, was analyzed by immunoprecipitation–blotting. Neither {alpha}6ß1 nor {alpha}6ß4 integrin was detected in the RIN cells (Fig 5), supporting the findings of our immunocytochemical studies. Immunoprecipitation–blotting further demonstrated that the {alpha}3-subunit is probably associated with ß1 to form {alpha}3ß1-integrin in mouse islet cells.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 5. Expression of integrin subunits in RIN A12 ß-cells. Pancreas cell lysate (A) served as a control for antibodies and experimental procedures. RIN cell lysates (B,C) were precipitated with rat monoclonal anti-mouse {alpha}6 integrin antibody (B) and mouse monoclonal anti-human {alpha}3 integrin antibody (C) blotted with rabbit anti-ß1 and goat anti-ß4 integrin antibodies, detected by peroxidase-conjugated sheep anti-rabbit and donkey anti-goat Ig.


*   Discussion
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

This study has characterized the expression pattern of laminins and their integrin receptors in the adult pancreas. Laminin isoform expression varied with tissue compartments in the pancreas but was not detected extracellularly in islets. Integrin receptor subunit expression had a cell-specific pattern. Laminin-1 was undetectable in the adult pancreas. We previously showed that laminin {alpha}1, unique for laminin-1, is expressed in the BM of developing pancreatic duct epithelium between E13.5 and E17.5 (Jiang et al. 1999 Down). However, laminin {alpha}1 was not detected in any compartment of the adult pancreas, consistent with our RT-PCR analysis and a recent report (Virtanen et al. 2000 Down). These data support the current view that laminin {alpha}1 is expressed in the epithelial BM during early development but not in the adult (Miner et al. 1997 Down; Virtanen et al. 2000 Down), and imply that laminin-1 may be involved in the proliferation (through {alpha}6 integrins) and differentiation (via {alpha}-dystroglycan) of the pancreatic precursor cells (Jiang et al. 2001 Down). Strong staining of laminin ß1- and {gamma}1-chains and weak staining of laminin {alpha}5-chain indicated the existence of laminin-10 ({alpha}5ß1{gamma}1) in the BM of acinar cells, consistent with the notion that laminin-10 is an adult isoform of epithelial laminin (Ferletta and Ekblom 1999 Down). Laminin {alpha}2, {alpha}5, ß1, {gamma}1 and {gamma}2 were detected in blood vessels, especially arteries, indicating that laminin-2 ({alpha}2ß1{gamma}1), -8 ({alpha}4ß1{gamma}1), and -10 are expressed in the BM of these tissues. The functional significance of these laminin isoforms expressed in the blood vessels remains to be determined.

Our results show that major ECM proteins are absent extracellularly between islet cells, as are nidogen-1 and fibulin-1 and -2. Similarly, a range of collagen isoforms—fibronectin, vitronectin, and elastin—were not detected between islet cells (van Deijnen et al. 1992 Down; Meyer et al. 1997 Down).

These studies provide molecular evidence to support a previous electron microscopic study (Like et al. 1978 Down) that a BM structure is not found around islet cells. This feature may be related to the diffusion of secreted hormones into intra-islet capillary networks. Lack of ECM proteins between islet cells indicates that the function of islet cells in vivo is regulated mainly by soluble factors and cell–cell interactions mediated, for example, by integrins (see below). However, in an artificial environment, the function of dispersed islet cells can be partially maintained by attachment to ECM in vitro. Thus, insulin secretion can be boosted by attachment to laminin-5 secreted by a rat carcinoma cell line (G804) (Baker et al. 1996 Down; Bosco et al. 2000 Down). Similarly, proinsulin, insulin content, and stimulated insulin release in cultured rat islets can be partially preserved by attachment to collagen II and fibronectin (Wang et al. 1999 Down).

Only a limited amount of information on the expression pattern of integrin subunits in the adult pancreas has hitherto been available. We found that the integrin {alpha}6-subunit was undetectable in adult mouse islet cells by indirect immunofluorescence and immunoprecipitation, consistent with previous immunochemical studies in several species, including humans (Terpe et al. 1994 Down; Kantengwa et al. 1997 Down; Wang et al. 1999 Down). This suggests that {alpha}6 integrin signaling is not required for adult ß-cell function. Because {alpha}6 integrins transduce a moderate proliferation signal in the developing pancreas (Jiang et al. 2001 Down), absence of {alpha}6 integrin expression in the adult islet cells may, at least partially, be attributed to the low proliferative potential of these cells. However, our observation contrasts with a report (Bosco et al. 2000 Down) that the {alpha}6-subunit is present on primary rat ß-cells. This discrepancy may be partially due to differences in experimental techniques and antibody used.

What is the dimerization partner for the integrin ß1 subunit on islet cells? There are six known members of the ß1 integrin subfamily: {alpha}1ß1, {alpha}2ß1, {alpha}3ß1, {alpha}6ß1, {alpha}7ß1, and {alpha}9ß1. Our study has demonstrated that the {alpha}6ß1 integrin is absent on mouse islet cells. However, we observed that the {alpha}3-subunit was weakly detected on islet cells, suggesting the existence of {alpha}3ß1 integrin. This was supported by our immunoprecipitation–blotting experiments on RIN cells and by the findings of others on primary and transformed rat islet cells (Kantengwa et al. 1997 Down; Wang et al. 1999 Down). {alpha}3ß1 integrin may also be at least partially responsible for binding to laminin-5 secreted by 804G cells, a rat carcinoma cell line, and for increasing proliferation of human fetal islet cells (Beattie et al. 1996 Down). In addition, the function of {alpha}3ß1 integrin may partially overlap with {alpha}6 integrins because the islet cell lineage develops normally in homozygous {alpha}6 gene knockout ({alpha}6-/-) mice (Jiang et al. 2001 Down), but not in double {alpha}6-/-/{alpha}3-/- mice (De Arcangelis et al. 1999 Down).

Integrin ß4-subunit expression is primarily restricted to cells of ectoderm- and endoderm-derived tissues, such as skin and intestine (Belkin and Stepp 2000 Down). This subunit is unique among integrins in that it has a very large cytoplasmic domain (~1000 amino acid residues compared to less than 50 residues in other integrin ß-subunits). The expression of {alpha}6ß4 in epithelial cells of various orders of pancreatic ducts may be associated with hemidesmosome formation along the basement membrane (Dowling et al. 1996 Down; van der Neut et al. 1996 Down).

In conclusion, laminin and its integrin receptors exhibit a selective pattern of expression in the adult pancreas. Understanding the functions of these molecules may facilitate the engineering of specific pancreatic cells such as insulin-producing ß-cells.


*   Acknowledgments

Supported by a Juvenile Diabetes Research Foundation Fellowship and a Diabetes Australia Research Grant (2001) (F-XJ) and by the National Health and Medical Research Council of Australia (LCH).

We thank Dr L.M. Sorokin (Institute of Experimental Medicine, University of Erlangen–Nurnburg, Germany), who kindly provided rat monoclonal anti-mouse laminin {alpha}1 (clone 198), {alpha}2 (clone 4H8), and {alpha}5 (clone 4G6) antibodies and rabbit anti-nidogen-1 (#913 and 914), fibulin-1 (#1034), and fibulin-2 (#1028) antibodies. We also thank Catherine O'Shea for secretarial assistance.

Received for publication June 10, 2002; accepted June 12, 2002.


*   Literature Cited
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Baker SE, DiPasquale AP, Stock EL, Quaranta V, Fitchmun M, Jones JC (1996) Morphogenetic effects of soluble laminin-5 on cultured epithelial cells and tissue explants. Exp Cell Res 228:262-270[Medline]

Beattie GM, Rubin JS, Mally MI, Otonkoski T, Hayek A (1996) Regulation of proliferation and differentiation of human fetal pancreatic islet cells by extracellular matrix, hepatocyte growth factor, and cell-cell contact. Diabetes 45:1223-1228[Abstract]

Belkin AM, Stepp MA (2000) Integrins as receptors for laminins. Microsc Res Tech 51:280-301[Medline]

Bosco D, Meda P, Halban PA, Rouiller DG (2000) Importance of cell-matrix interactions in rat islet beta-cell secretion in vitro: role of alpha6beta1 integrin. Diabetes 49:233-243[Abstract]

Burgeson RE, Chiquet M, Deutzmann R, Ekblom P, Engel J, Kleinman H, Martin GR et al. (1994) A new nomenclature for the laminins. Matrix Biol 14:209-211[Medline]

Colognato H, Yurchenco PD (2000) Form and function: the laminin family of heterotrimers. Dev Dyn 218:213-234[Medline]

De Arcangelis A, Mark M, Kreidberg J, Sorokin L, Georges–Labouesse E (1999) Synergistic activities of alpha3 and alpha6 integrins are required during apical ectodermal ridge formation and organogenesis in the mouse. Development 126:3957-3968[Abstract]

Dowling J, Yu QC, Fuchs E (1996) Beta4 integrin is required for hemidesmosome formation, cell adhesion and cell survival. J Cell Biol 134:559-572[Abstract/Free Full Text]

Erickson AC, Couchman JR (2000) Still more complexity in mammalian basement membranes. J Histochem Cytochem 48:1291-1306[Abstract/Free Full Text]

Falk M, Ferletta M, Forsberg E, Ekblom P (1999) Restricted distribution of laminin alpha1 chain in normal adult mouse tissues. Matrix Biol 18:557-568. [in process citation][Medline]

Ferletta M, Ekblom P (1999) Identification of laminin-10/11 as a strong cell adhesive complex for a normal and a malignant human epithelial cell line. J Cell Sci 112:1-10[Abstract]

Gazdar AF, Chick WL, Oie HK, Sims HL, King DL, Weir GC, Lauris V (1980) Continuous, clonal, insulin- and somatostatin-secreting cell lines established from a transplantable rat islet cell tumor. Proc Natl Acad Sci USA 77:3519-3523[Abstract/Free Full Text]

Hogervorst F, Kuikman I, van Kessel AG, Sonnenberg A (1991) Molecular cloning of the human alpha 6 integrin subunit. Alternative splicing of alpha 6(mRNA and chromosomal localization of the alpha 6 and beta 4 genes. Eur J Biochem 199):425-433

Jiang FX, Cram DS, DeAizpurua HJ, Harrison LC (1999) Laminin-1 promotes differentiation of fetal mouse pancreatic beta-cells. Diabetes 48:722-730[Abstract]

Jiang FX, Georges–Labouesse E, Harrison LC (2001) Regulation of laminin 1-induced pancreatic beta-cell differentiation by alpha6 integrin and alpha-dystroglycan. Mol Med 7:107-114[Medline]

Kantengwa S, Baetens D, Sadoul K, Buck CA, Halban PA, Rouiller DG (1997) Identification and characterization of alpha 3 beta 1 integrin on primary and transformed rat islet cells. Exp Cell Res 237:394-402[Medline]

Lelievre S, Weaver VM, Bissell MJ (1996) Extracellular matrix signaling from the cellular membrane skeleton to the nuclear skeleton: a model of gene regulation. Re Prog Horm Res 51:417-432

Like AA, Appel MC, Williams RM, Rossini AA (1978) Streptozotocin-induced pancreatic insulitis in mice. Morphologic and physiologic studies. Lab Invest 38:470-486[Medline]

Maatta M, Virtanen I, Burgeson R, Autio–Harmainen H (2001) Comparative analysis of the distribution of laminin chains in the basement membranes in some malignant epithelial tumors: the alpha1 chain of laminin shows a selected expression pattern in human carcinomas. J Histochem Cytochem 49:711-726[Abstract/Free Full Text]

Meyer T, Czub S, Chodnewska I, Beutner U, Hamelmann W, Klock G, Zimmermann U et al. (1997) Expression pattern of extracellular matrix proteins in the pancreas of various domestic pig breeds, the Goettingen Minipig and the wild boar. Ann Transplant 2:17-26[Medline]

Miner JH, Patton BL, Lentz SI, Gilbert DJ, Snider WD, Jenkins NA, Copeland NG et al. (1997) The laminin alpha chains: expression, developmental transitions, and chromosomal locations of alpha1-5, identification of heterotrimeric laminins 8–11, and cloning of a novel alpha3 isoform. J Cell Biol 137:685-701[Abstract/Free Full Text]

Pujuguet P, Simian M, Liaw J, Timpl R, Werb Z, Bissell MJ (2000) Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression. J Cell Sci 113:849-858[Abstract]

Sorokin LM, Pausch F, Durbeej M, Ekblom P (1997) Differential expression of five laminin alpha (1–5) chains in developing and adult mouse kidney. Dev Dyn 210:446-462[Medline]

Terpe HJ, Stark H, Ruiz P, Imhof BA (1994) Alpha 6 integrin distribution in human embryonic and adult tissues. Histochemistry 101:41-49[Medline]

Timpl R, Brown JC (1996) Supramolecular assembly of basement membranes. Bioessays 18:123-132[Medline]

Tunggal P, Smyth N, Paulsson M, Ott MC (2000) Laminins: structure and genetic regulation. Microsc Res Tech 51:214-227[Medline]

van Deijnen JH, Hulstaert CE, Wolters GH, van Schilfgaarde R (1992) Significance of the peri-insular extracellular matrix for islet isolation from the pancreas of rat, dog, pig, and man. Cell Tissue Res 267:139-146[Medline]

van der Neut R, Krimpenfort P, Calafat J, Niessen CM, Sonnenberg A (1996) Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice. Nature Genet 13:366-369[Medline]

Virtanen I, Gullberg D, Rissanen J, Kivilaakso E, Kiviluoto T, Laitinen LA, Lehto VP, Ekblom P (2000) Laminin alpha1-chain shows a restricted distribution in epithelial basement membranes of fetal and adult human tissues. Exp Cell Res 257:298-309[Medline]

Wang RN, Paraskevas S, Rosenberg L (1999) Characterization of integrin expression in islets isolated from hamster, canine, porcine, and human pancreas. J Histochem Cytochem 47:499-506[Abstract/Free Full Text]

Yurchenco PD, O'Rear JJ (1994) Basal lamina assembly. Curr Opin Cell Biol 6:674-681[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
G. Parnaud, E. Hammar, D. G. Rouiller, M. Armanet, P. A. Halban, and D. Bosco
Blockade of {beta}1 Integrin-Laminin-5 Interaction Affects Spreading and Insulin Secretion of Rat {beta}-Cells Attached on Extracellular Matrix.
Diabetes, May 1, 2006; 55(5): 1413 - 1420.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
B. Gleason, B. Adley, M. S. Rao, and L. K. Diaz
Immunohistochemical Detection of the {beta}4 Integrin Subunit in Pancreatic Adenocarcinoma
J. Histochem. Cytochem., June 1, 2005; 53(6): 799 - 801.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
J. H. Miner, C. Li, and B. L. Patton
Laminins {alpha}2 and {alpha}4 in Pancreatic Acinar Basement Membranes Are Required for Basal Receptor Localization
J. Histochem. Cytochem., February 1, 2004; 52(2): 153 - 156.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, F.-X.
Right arrow Articles by Harrison, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, F.-X.
Right arrow Articles by Harrison, L. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact