Journal of Histochemistry and Cytochemistry
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alenina, N.
Right arrow Articles by Walther, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alenina, N.
Right arrow Articles by Walther, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Histochemistry and Cytochemistry, Vol. 50, 691-696, May 2002, Copyright © 2002, The Histochemical Society, Inc.


ARTICLE

Cell Type-specific Expression of the Mas Proto-oncogene in Testis

Natalia Aleninab,c, Tatjana Baranovad, Eugene Smirnowd, Michael Baderb, Andrea Lippoldtb, Eugene Patkind, and Thomas Walthera
a Department of Cardiology, University Hospital Benjamin Franklin (UKBF), Free University of Berlin
b Max-Delbrück-Center for Molecular Medicine (MDC), Berlin-Buch, Germany
c Institute of Cytology, Russian Academy of Medical Science, Saint Petersburg, Russia
d Institute of Experimental Medicine, Russian Academy of Medical Science, Saint Petersburg, Russia

Correspondence to: Thomas Walther, University Hospital Benjamin Franklin, Dept. of Cardiology and Pneumology, Free University of Berlin, Hindenburgdamm 30, D-12200 Berlin, Germany. E-mail: thomas.walther@ukbf.fu-berlin.de


*   Summary
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

The Mas proto-oncogene encodes a G-protein-coupled receptor with the common seven transmembrane domains and may be involved in the actions of angiotensins. Because Mas is highly expressed in testis, we investigated the cell type-specificity and the onset of expression of the gene in this organ. Using an RNase protection assay, it could be shown that neither whole testes nor cultured Sertoli and Leydig cells of 12-day-old mice express Mas mRNA. Mas expression is first detected in 18-day-old mice and thereafter increases continuously until 6 months of age. By in situ hybridization, the expression could be localized to Leydig cells and Sertoli cells, the signals being much more pronounced in the former. A weak signal was detected in primary spermatocytes. The strong ontogenetically controlled and cell type-specific expression of this membrane-bound receptor in testis implicates a role for the Mas proto-oncogene in testis maturation and function.

(J Histochem Cytochem 50:691–695, 2002)

Key Words: Mas proto-oncogene, in situ hybridization, Leydig cells, Sertoli cells, RNase protection assay


*   Introduction
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

THE Mas proto-oncogene was first detected through its tumorigenic activity in in vivo tumor assays (Young et al. 1986 Down). It codes for a protein belonging to the class of G-protein-coupled receptors with seven transmembrane domains and is believed to be involved in the actions of angiotensin II (AngII) (Jackson et al. 1988 Down; von Bohlen und Halbach et al. 2000 Down). However, Ambroz et al. 1991 Down showed that the intracellular Ca2+ increase in Mas-transfected cells after AngII treatment is observed only in cells that endogenously express the AngII receptor AT1. Therefore, Mas is not per se an AngII receptor but appears to be a modulator of G-protein coupled receptor signaling at least for the AT1 receptor. In mammals the gene is expressed predominantly in testis and in distinct areas of forebrain such as the hippocampus and amygdala (Bunnemann et al. 1990 Down; Martin et al. 1992 Down) and, less strongly but detectable, in kidney and heart of rodents (Villar and Pedersen 1994 Down; Metzger et al. 1995 Down). Metzger et al. 1995 Down have shown that Mas expression in rat testis increases beginning at 5 weeks after birth, reaching highest concentrations 15 weeks after birth. The high mRNA level in testis indicates a role of the Mas protein in fertility and reproduction. However, Mas-deficient mice recently generated by our group did not show a reduction in male fertility (Walther et al. 1998 Down), of which may be due to compensatory mechanisms. To answer the question of which cell type in the testis expresses Mas mRNA we analyzed the expression sites in mouse testis using cell culture, RNase protection assays (RPAs), and in situ hybridization.


*   Materials and Methods
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Animals
Inbred mice of different ages were used for the experiments. The animals were maintained under standardized conditions with an artificial 12-hr dark–light cycle, with free access to food and water. Animals were sacrificed by cervical dislocation. After preparation, all tissue samples were immediately snap-frozen in liquid nitrogen. This research was in compliance with the Guide for the Care and Use of Laboratory Animals published by the OPRR (Office for Protection against Research Risks) of the National Institutes of Health (Washington, DC) (NIH Publication No. 85-23, revised 1985).

Cell Culture
Commercially available cell lines TM3 (testis, Leydig cell, mouse BALB/c, isolated from 11–13-day-old animals) and TM4 (testis, Sertoli cell, mouse BALB/c, isolated from 11–13-day-old mice) from ATCC (American Type Culture Collection; Manassas, VA) were used for cell culture experiments. For at least 3 days, cells were grown in a monolayer (94/16-mm Petri dish) in medium as recommended by ATCC.

RNA Isolation
RNA from cultured cells was isolated using TRIzol reagent (Life Technologies; Gaithersburg, MD). Cells were lysed by adding 1.5 ml of TRIzol reagent to the culture dish. Each cell lysate was transferred to a 2-ml Eppendorf tube and centrifuged (12,000 x g, 15 min, 4C) after adding 0.3 ml of chloroform. The upper aqueous phase was transferred to a fresh tube and RNA was precipitated by mixing with 1 ml of isopropanol. Probes were centrifuged (12,000 x g, 10 min, 4C). After an additional washing step, the RNA pellet was air-dried and dissolved in DEPC-treated water. RNA of mouse organs was also isolated using TRIzol reagent according to the manufacturer's protocol, as described previously (Stepan et al. 1999 Down).

RNase Protection Assay
Mas expression was analyzed by RPA using commercially available Ambion RPA II kits (AMS Biotechnology; Witney, UK), according to the protocol of the manufacturer. Thirty µg total RNA of testis, brain, and cultured cells and 50 µg of yeast as a control were used for RPA. Via PCR, a 175-bp fragment was amplified from mouse Mas cDNA using the 5' primer CAAGCCTCTAGCCCTCTGTCC and the 3' primer GGAGGCATTTCTGCTGGAGG and subcloned in a T-vector (Promega; Mannheim, Germany). A T7-polymerase reaction transcribed a 225-bp radioactive probe complementary to the 175 nucleotides of the Mas mRNA and a 144-bp radioactive probe complementary to 127 nucleotides of the mRNA encoding the L32 housekeeping gene (commercially available L32 probe template; PharMingen International, San Diego, CA). RNA samples were hybridized with approximately 20,000 cpm of the radiolabeled Mas antisense probe and 10,000 cpm of the L32 antisense probe. The hybridized fragments, once protected from RNase A + T1 digestion, were separated by electrophoresis on a denaturing gel (5% polyacrylamid, 8 M urea) and analyzed using a FUJIX BAS 2000 Phospho-Imager system (Raytest GmbH; Straubenhardt, Germany).

Tissue Collection, Fixation, and Processing
Adult (4-month-old) male mice were used for experiments. Mas knockout mice of relevant age were used as a negative control. The animals were sacrificed by cervical dislocation, testes were quickly removed and fixed at 4C in 4% paraformalde/1 x PBS for 12 hr, dehydrated in ethanol, and embedded in paraffin for histology and in situ hybridization according to standard techniques. Serial cross-sections of testis (5–8-µm thickness) were mounted on Superfrost plus slides (Menzel Glass; Braunschweig, Germany), deparaffinized, and kept at -70C. On the day of the experiment, the testis sections were quickly brought to room temperature and used for in situ hybridization. For histological examination, sections were counterstained with hematoxylin and eosin.

DNA–RNA In Situ Hybridization
Control slides were digested with RNase A (400 µg/ml for overnight), and washed three times in fresh 2 x SSC (pH 7.0). All slides were rinsed briefly in 1 x PBS and incubated for 12 min in pepsin solution (10 mg/100 ml 0.01 M HCl). After 5-min rinsing in 1 x PBS, the sections were postfixed in 3% paraformaldehyde, rinsed in 1 x PBS, dehydrated in graded ethanol up to 95%, and air-dried. For in situ hybridization, a Mas–DNA probe, spanning positions from -165 to +150 in relation to the translation start site of Mas (Metzger et al. 1995 Down), was biotinylated according to a standard nick-translation protocol. The labeled probe was diluted in hybridization mixture [50% formamide/2 x SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0)/10% dextran sulfate/50 mM sodium phosphate/0.1% SDS/1 x Denhardt's solution (0.02% polyvinylpyrrolidone/0.02% Ficoll/0.02% bovine serum albumin), pH 7.0] to a final concentration of 3–5 ng/ml. Then it was denatured for 5 min at 95C, quick-chilled on ice, and immediately applied to the slide. The hybridization was performed over a period of 18–20 hr at 38C in a humid environment. After three post-hybridization washing steps in 50% formamide/2 x SSC and three changes of 2 x SSC, nonspecific binding was blocked with 1% blocking reagent (Roche; Mannheim, Germany)/4 x SSC, and hybridization signals were detected by one layer of avidin–FITC conjugate (Vector Labs; Burlingame, CA). After a last washing three times in 4 x SSC, the slides were dehydrated serially in ethanol, air-dried, and then mounted in antifade solution, (90% glycerol, 0.02 M Tris-HCl, pH 8.0, 2.3% DABCO, 0.5 µg/ml propidium iodide).

After in situ hybridization, sections were examined under a Leica fluorescent microscope equipped with an HBO100 lamp, a x63 or x40 (NA 1.6) oil immersion objective, and an appropriate set of optical filters. Images of metaphase and interphase preparations were recorded using a CCD camera connected to a Q-FISH image analysis system. In addition, the following controls were prepared: slides were processed as described above but in the absence of labeled probe, or slides were processed as described above but with biotin-labeled pBR 322 without insert.


*   Results
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

To localize the expression of the Mas proto-oncogene to a cell type in testis, commercially available Leydig (TM3) and Sertoli cell lines (TM4), originally isolated from 11–13-day-old mice, were cultured. RNA from these cells was isolated and used in RPA to detect Mas gene expression (Fig 1). Neither Leydig nor Sertoli cell lines from young mice showed any detectable Mas expression. Furthermore, Mas mRNA was not found in the testis of a 2-week-old mouse. In contrast, forebrain and testis RNA of an adult (3-month-old) mouse gave signals, which were strongest in the adult testes. All RNA used showed a similar expression of the housekeeping gene L32, confirming the integrity of the RNA.



View larger version (93K):
[in this window]
[in a new window]
 
Figure 1. RNase protection assay of different cell types and organs using a specific cDNA probe Mas (225 bp) for the Mas proto-oncogene (protected fragment of 175 bp) and a specific cDNA probe L32 (144 bp) for the L32 mRNA (protected fragment of 127 bp) as a housekeeping gene. Lanes showing RNA of: F, forebrain of a 3-month-old mouse; T, testis of a 3-month-old mouse; 14 d, testis of a 14-day-old mouse; TM3, TM3 cells; TM4, TM4 cells; Y+, yeast plus RNase; Y-, yeast without RNase.

To examine the ontogenetic profile of Mas expression in testis, animals at the age of 16, 18, 20, 22, 25, 30 days and 1.5, 3, and 6 months were analyzed. For each time point, RNA of six testes isolated from mice of independent litters was used for RPA (Fig 2A). Mas expression was undetectable in testis of 16-day-old mice and started to be visible in 18-day-old animals. Then it continued to increase from 20 days to 6 months of age (Fig 3). To exclude a first peak of Mas expression after birth and to clarify whether there is a further increase in Mas mRNA in old animals, we also characterized the Mas expression in neonatal testes and testes of 1-year-old mice. Although no Mas mRNA could be detected after birth, there was also no further elevation in Mas expression in 12-month-old animals compared to 6-month-old mice (Fig 2B and Fig 3).



View larger version (83K):
[in this window]
[in a new window]
 
Figure 2. Age-dependent expression of the Mas proto-oncogene in mouse testis. Representative RNase protection assays with testis at different time points, using the probe Mas (protected fragment of 175 bp). The presence of RNA in all probes is demonstrated by simultaneous hybridization to the L32 probe (protected fragment 127 bp). Lanes show RNA of testis, isolated from mice. (A) 16 d, 16 days old; 18 d, 18 days old; 20 d, 20 days old; 22 d, 22 days old; 25 d, 25 days; 30 d, 30 days old; 1.5 m, 1.5 months old; 3 m, 3 months old; 6 m, 6 months old; Y+, yeast plus RNase; Y-, yeast without RNase. (B) NB, newborns; 6 m, 6 months old; 12 m, 12 months old; Y+, yeast plus RNase; Y-, yeast without RNase.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 3. Comparison of Mas mRNA expression in mouse testis at different time points. The level of Mas mRNA expression in 25-day-old mouse testis is taken as 100%. Results are expressed as mean ± SEM (n=6 for each time point).

To identify the cell type expressing the Mas in the adult testis in vivo, four testes of 3-month-old mice were isolated and prepared for fluorescent in situ hybridization (FISH). Using this technique, a distinct expression of Mas gene was detectable in both Leydig and Sertoli cells (Fig 4), the signal being much stronger in Leydig cells. In addition, weak expression could be detected in some round cells in the presumptive position of primary spermatocytes. The result was reproducible in all testes. Mas mRNA was not observed in later stages of the germ-cell lineage. No signal was observed in testes of Mas-deficient mice used as controls (data not shown).



View larger version (119K):
[in this window]
[in a new window]
 
Figure 4. In situ hybridization using FISH with a biotinylated fragment of the Mas gene on paraffin sections of mouse testis. (A) Magnification x63; (C) magnification x40 [note preferable Mas mRNA localization in Leydig (LC) compared to Sertoli cells (SC)]; and respective hematoxylin-eosin staining with (B) magnification x63 and (D) magnification x40.


*   Discussion
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Because it was shown that expression of the Mas proto-oncogene is highest in testis of mice, it was of great interest to analyze the ontogenetic profile and the cell type specifity of the Mas expression in this organ. Using RPA, we could demonstrate strong expression of the Mas gene in adult mouse testis, whereas the whole organ or lines of Leydig and Sertoli cells isolated from young mice did not show any Mas mRNA expression. In these cell lines it was not possible to clarify which cell type is responsible for the strong Mas expression in an adult murine testis. Therefore, the results show that TM3 and TM4 may be good models for young testicular cells but may not be representative for adult Leydig and Sertoli cells, respectively. Furthermore, it should be noted that TM3 and TM4 are permanent cell lines and may have lost some characteristics of the cell type of origin.

As described for rats (Metzger et al. 1995 Down), our data demonstrate a well-controlled regulation of Mas expression in testis beginning 18 days after birth and increasing until 6 months of age. This continuous increase in Mas mRNA level indicates that Mas is not just involved in the maturation process of testis, indicated by a dramatic upregulation between 16 and 25 days, but may be also implicated in the function of the mature organ. Additional experiments using in situ hybridization demonstrated a distinct expression of the Mas gene in both Leydig and Sertoli cells, the signals being much more pronounced in Leydig cells. Whereas primary spermatocytes showed a weak Mas expression, cells of a later stage in germ-cell differentiation are free of Mas mRNA. Therefore, the testicular expression of the Mas proto-oncogene is cell type-specific and depends on the age of the animal.

Because we could not detect any Mas expression in newborn mice, the expression of Mas in fetal Leydig cells seems unlikely. The onset of Mas expression between Days 35 and 56 in the rat (Metzger et al. 1995 Down) and Days 18 and 25 in the mouse coincides with the differentiation and maturation of adult Leydig cells, which are not derived from pre-existing fetal Leydig cells (Habert et al. 2001 Down). Therefore, Mas is a marker for adult Leydig cells and may be involved in the function of this cell type.

Mas is not expressed in tissues of the female genital tract (data not shown) and therefore cannot interact with the components of the renin–angiotensin system (RAS) detected in ovary (for review see Speth et al. 1999 Down). However, our findings suggest that Mas may be involved in the effects of the testicular RAS (Vinson et al. 1997 Down), although the role of this system in testis is still under investigation. One of its components, the angiotensin-converting enzyme (ACE), has already been implicated in the penetration of sperm into oocytes during the process of fertilization (Hagaman et al. 1998 Down). Because we could not detect any Mas expression in spermatozoa, an interaction between ACE and Mas in this process is very unlikely. Since animals deficient for the Mas proto-oncogene (Walther et al. 1998 Down) have a normal litter size, Mas does not appear to be essential for fertility. Therefore, further studies in these knockout animals will be needed to clarify the physiological role of this G-protein-coupled receptor in testis maturation and function.


*   Acknowledgments

Supported in part (EP and TB) by RFBR grant no. 98-04-50002 and by an MDC fellowship (NA).

Received for publication July 26, 2001; accepted December 5, 2001.


*   Literature Cited
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Ambroz C, Clark AJL, Catt KJ (1991) The mas oncogene enhances angiotensin-induced [Ca2+]i responses in cells with pre-existing angiotensin II receptors. Biochim Biophys Acta 1133:107-111[Medline]

Bunnemann B, Fuxe K, Metzger R, Mullins J, Jackson TR, Hanley MR, Ganten D (1990) Autoradiographic localization of mas proto-oncogene mRNA in adult rat brain using in situ hybridization. Neurosci Lett 114:147-153[Medline]

Habert R, Lejeune H, Saez JM (2001) Origin, differentiation and regulation of fetal and adult Leydig cells. Mol Cell Endocrinol 179:47-74[Medline]

Hagaman JR, Moyer JS, Bachman ES, Sibony M, Magyar PL, Welch JE, Smithies O, Krege JH, O'Brien DA (1998) Angiotensin-converting enzyme and male fertility. Proc Natl Acad Sci USA 95:2552-2557[Abstract/Free Full Text]

Jackson TR, Blair AC, Marshall J, Goedert M, Hanley MR (1988) The mas oncogene encodes an angiotensin receptor. Nature 335:437-440[Medline]

Martin KA, Grant SGN, Hockfield S (1992) The mas proto-oncogene is developmentally regulated in the rat central nervous system. Dev Brain Res 68:75-82[Medline]

Metzger R, Bader M, Ludwig T, Berberich C, Bunnemann B, Ganten D (1995) Expression of the mouse and rat mas proto-oncogene in the brain and peripheral tissues. FEBS Lett 357:27-32[Medline]

Speth RC, Daubert DL, Grove KL (1999) Angiotensin II: a reproductive hormone too? Regul Pept 79:25-40[Medline]

Stepan H, Faber R, Walther T (1999) Expression of low-density lipoprotein receptor messenger ribonucleic acid in placentas from pregnancies with preterm delivery and pregnancies with intrauterine growth retardation. Br J Obst Gynaecol 106:1221-1222[Medline]

Villar AJ, Pedersen RA (1994) Parental imprinting of the Mas protooncogene in mouse. Nature Genet 8:373-379[Medline]

Vinson GP, Saridogan E, Puddefoot JR, Dajahanbakhch O (1997) Tissue renin-angiotensin systems and reproduction. Hum Reprod 12:651-662[Abstract/Free Full Text]

von Bohlen und Halbach O, Walther T, Bader M, Albrecht D (2000) Interaction between Mas and the angiotensin AT1 receptor in the amygdala. J Neurophysiol 83:2012-2019[Abstract/Free Full Text]

Walther T, Balschun D, Voigt JP, Fink H, Zuschratter W, Birchmeier C, Ganten D, Bader M (1998) Sustained long-term potentiation and anxiety in mice lacking the Mas protooncogene. J Biol Chem 273:11867-11873[Abstract/Free Full Text]

Young D, Waitches G, Birchmeier C, Fasano O, Wigler M (1986) Isolation and characterization of a new cellular oncogene encoding a protein with multiple potential transmembrane domains. Cell 45:711-719[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Exp PhysiolHome page
R. A. S. Santos, A. J. Ferreira, and A. C. Simoes e Silva
Recent advances in the angiotensin-converting enzyme 2-angiotensin(1-7)-Mas axis
Exp Physiol, May 1, 2008; 93(5): 519 - 527.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. A. Botelho-Santos, W. O. Sampaio, T. L. Reudelhuber, M. Bader, M. J. Campagnole-Santos, and R. A. Souza dos Santos
Expression of an angiotensin-(1-7)-producing fusion protein in rats induced marked changes in regional vascular resistance
Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2485 - H2490.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alenina, N.
Right arrow Articles by Walther, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alenina, N.
Right arrow Articles by Walther, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact