Journal of Histochemistry and Cytochemistry Priciples for Free Access to Science
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayashi, M.
Right arrow Articles by Moriyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayashi, M.
Right arrow Articles by Moriyama, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Journal of Histochemistry and Cytochemistry, Vol. 51, 1375-1390, October 2003, Copyright © 2003, The Histochemical Society, Inc.


ARTICLE

Expression and Localization of Vesicular Glutamate Transporters in Pancreatic Islets, Upper Gastrointestinal Tract, and Testis

Mitsuko Hayashi1,a, Riyo Morimotoa, Akitsugu Yamamoto2,b, and Yoshinori Moriyamaa
a Department of Biochemistry, Faculty of Pharmaceutical Sciences, Okayama University, Okayama, Japan
b Department of Physiology, Kansai Medical University, Moriguchi, Osaka, Japan

Correspondence to: Yoshinori Moriyama, Dept. of Biochemistry, Faculty of Pharmaceutical Sciences, Okayama University, Okayama 700-8530, Japan. E-mail: moriyama@pheasant.pharm.okayama-u.ac.jp


*   Summary
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

The wide-ranging expression of glutamate receptors in peripheral tissues suggests an unexpectedly wider role(s) of L-glutamate as an intercellular signaling molecule. However, the peripheral glutamatergic system is poorly understood, partly because the sites of L-glutamate signal appearance are less well characterized. Vesicular glutamate transporters (VGLUTs) are potential probes for the sites of vesicular storage and subsequent secretion of L-glutamate. In this study we raised specific polyclonal antibodies against two VGLUT isoforms, VGLUT1 and VGLUT2, and investigated their localization in peripheral tissues of rat. We detected the expression of either VGLUT1 or VGLUT2, or both, in pancreas, stomach, intestine, and testis. In pancreas, VGLUT1 and VGLUT2 are present in pancreatic polypeptide-containing secretory granules in F-cells in the islets of Langerhans. In stomach, VGLUT2 is abundant in the antrum and pylorus and is present in a subset of pancreatic polypeptide-containing cells. In intestine, VGLUT2 is abundant in the ileum and is co-localized with glucagon-like immunoreactive peptide and polypeptide YY (PYY). In testis, VGLUT2 is expressed and localized in the outer acrosomal membrane of spermatids, where KA1 and GluR5, kainate receptor subunits, are almost always localized. Taken together, these results strongly suggest the occurrence of a peripheral glutamatergic system in the gastroenteropancreatic system and testis. (J Histochem Cytochem 51:1375–1390, 2003)

Key Words: L-glutamate, vesicular glutamate, transporters (VGLUT1,, VGLUT2), spermatid, acrosome, gastroenteropancreatic system, L-cells, islet of Langerhans


*   Introduction
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

L-Glutamate is an excitatory chemical transmitter that plays an essential role in neuronal plasticity, behavior, learning, and memory in the central nervous system (Foster and Fagg 1984 Down; Mayer and Westbrook 1987 Down). To use L-glutamate as a signaling molecule, neuronal cells have developed glutamatergic systems involving signal reception through glutamate receptors, signal termination through Na+-dependent glutamate transporters, and signal output through vesicular storage and successive exocytosis of L-glutamate. Recent evidence indicates that various kinds of glutamate receptors are expressed throughout peripheral tissues, suggesting that L-glutamate functions as a chemical transmitter in these tissues (Moriyama et al. 2000 Down; Skerry and Genever 2001 Down). For example, pinealocytes, endocrine cells for melatonin, possess endogenous glutamatergic systems. The cells store L-glutamate in synapse-like microvesicles and secrete it on stimulation (Moriyama et al. 2000 Down). The released L-glutamate may in turn bind to class II metabotropic glutamate receptors, causing inhibition of melatonin synthesis through an inhibitory cAMP cascade (Yamada et al. 1998 Down). An excess amount of L-glutamate can be sequestered through a GLT-1-type plasma membrane glutamate transporter (Yatsushiro et al. 1997 Down). The islets of Langerhans, miniature endocrine organs that secrete hormones regulating the blood glucose concentration, constitute another example of a peripheral glutamatergic system. L-Glutamate is stored in glucagon-containing secretory granules in {alpha}-cells and is secreted through exocytosis on low-glucose stimulation (Hayashi et al. 2003 Down). These endocrine cells possess all components of a glutamatergic system. Therefore, these glutamatergic systems can be called peripheral glutamatergic systems (Moriyama et al. 2000 Down; Hayashi et al. 2001 Down, Hayashi et al. 2003 Down).

Vesicular glutamate transporters (VGLUTs) play an essential role in glutamate signal output through vesicular storage of L-glutamate (Otis 2001 Down). Thus far, three kinds of isoforms have been identified, i. e., VGLUT1 (Bellocchio et al. 2000 Down; Takamori et al. 2000 Down), VGLUT2 (Bai et al. 2001 Down; Fremeau et al. 2001 Down; Hayashi et al. 2001 Down; Herzog et al. 2001 Down; Takamori et al. 2001 Down; Varoqui et al. 2002 Down), and VGLUT3 (Fremeau et al. 2002 Down; Gras et al. 2002 Down; Schafer et al. 2002 Down; Takamori et al. 2002 Down). VGLUTs appear to be potential and useful probes for exploring peripheral glutamatergic systems because their presence directly indicates sites for the L-glutamate signal. In fact, VGLUT2 is present in glucagon-containing {alpha}-cells and in pancreatic polypeptide-containing F-cells and clonal islet cells (Hayashi et al. 2001 Down, Hayashi et al. 2003 Down; Bai et al. 2003 Down). VGLUT1 is also expressed in a subpopulation of islet {alpha}-cells (Hayashi et al. 2003 Down). In {alpha}-cells, VGLUT1 and VGLUT2 are localized with glucagon-containing secretory granules (Hayashi et al. 2003 Down). VGLUT1 and VGLUT2 are also present in synapse-like microvesicles in pinealocytes (Hayashi et al. 2001 Down; Morimoto et al. 2003 Down), consistent with the glutamatergic nature of these cells.

In this study we investigated the expression and localization of VGLUT1 and VGLUT2 in non-neuronal cells of rat peripheral tissues using specific antibodies with special reference to pancreas, stomach, intestine, and testis. Because the GI contains more than 18 kinds of endocrine cells (Solcia et al. 1987 Down), we expected that some of these cells would exhibit a glutamatergic phenotype, as in the case of islets of Langerhans. The testis expresses glutamate receptors (Storto et al. 2001 Down), indicating that some cells are glutamatergic in nature. Here we show that VGLUT1 and VGLUT2 are present in pancreatic polypeptide-containing secretory granules of F-cells in the islets of Langerhans and that VGLUT2 is present in a subset of pancreatic polypeptide-containing stomach cells, L-cells containing glucagon-like immunoreactive peptide and PYY in ileum mucosa, and acrosomes of testicular spermatids. These results strongly suggest that L-glutamate functions as an intercellular or intracellular messenger in these peripheral tissues.


*   Materials and Methods
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Animals
Male Wistar rats at 7–8 postnatal weeks were used throughout the study. All animal use procedures and care were in fully accordance with guidelines for the animal care at Okayama University.

Antibodies
DNA fragments encoding the C-terminal cytosolic regions of VGLUT1 (198 bp) (Ni et al. 1994 Down) and VGLUT2 (270 bp) (Aihara et al. 2000 Down), which correspond to G509–Y560 and G500–S582, respectively, were amplified by PCR and then cloned into the EcoRI site of expression vector pGEX3X for VGLUT1 and pGEX4T-2 for VGLUT2 (Amersham Pharmacia Biotech; Piscataway, NJ) to form GST fusion plasmids. The expression plasmids were transformed to E. coli BL21, and the resultant transformants were cultured and harvested after induction with 1 mM isopropyl 1-thio-ß-D-galactoside for 3 hr. The E. coli cells were suspended in 50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM EDTA, and 1 mM dithiothreito, and vigorously sonicated, and the resultant mixture was centrifuged. The supernatant was applied to a 1 ml glutathione–Sepharose 4B column (Amersham Pharmacia Biotech). The GST fusion peptides encoding G509–S560 for VGLUT1 and G500–Y582 for VGLUT2 were eluted by addition of the same buffer containing 16 mM reduced glutathione. The GST fusion proteins were injected into rabbits with complete adjuvant two times with a 2-week interval. Because the amino acid sequences of these antigens are different from each other, anti-VGLUT1 antibodies do not recognize VGLUT2, and vice versa (Fig 1). Pre-absorbed antibodies were prepared on incubation of antisera (50 µl) with antigenic peptides (2 mg) on ice bath for 10 hr. Mouse monoclonal antibodies (MAbs) against glucagon, insulin, synaptophysin (SY38), serotonin, and acrosin (ACR-2) were obtained from Sigma (St Louis, MO), Progen (Heidelberg, Germany), NeoMarkers (Fremont, CA), and Monosan (Uden, The Netherlands), respectively. Rabbit polyclonal antibodies against gastrin and rat monoclonal antibodies against somatostatin were from Chemicon (Temecula, CA). Guinea pig polyclonal antisera against rat pancreatic polypeptide and PYY were from Linco Research (St Charles, MO) and Progen, respectively. Mouse MAbs against vesicular acetylcholine transporter (VAchT) were from Promega (Madison, WI). Goat polyclonal antibodies against GluR5 were from Santa Cruz Biotechnology (Santa Cruz, CA). Guinea pig polyclonal antibodies against the amino-terminal region of KA1 were kindly supplied by Dr. M. Morita (Tokyo College of Pharmacy, Japan). Dilution of the antibodies for indirect immunofluorescence microscopy is as follows: VGLUT1, 500; VGLUT2, 500; glucagon, 500,000; pancreatic polypeptide, 50; synaptophysin, 20, serotonin, 200; acrosin, 2000; gastrin, 200; somatostatin, 500; VAchT, 500; GluR5, 10; KA1, 10.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Immunological specificities of antibodies against VGLUT1 and VGLUT2. COS7 cells expressing VGLUT1 or VGLUT2 were cultured. The membrane fraction was solubilized with SDS sample buffer and aliquots (50 µg protein) were subjected to SDS-PAGE and then immunoblotting was performed with anti-VGLUT1 antibodies (A) or anti-VGLUT2 antibodies (B). (A) Lane 1, synaptic vesicles (20 µg protein); Lane 2, COS7 cells (vector only); Lanes 3 and 5, COS7 cells expressing VGLUT1; Lane 4, COS7 cells expressing VGLUT2. In Lane 5, antibodies pre-absorbed with antigenic polypeptide (2 mg) were used. (B) Lane 1, synaptic vesicles (20 µg protein); Lanes 2 and 5, COS7 cells expressing VGLUT2; Lane 3, COS7 cells (vector only); Lane 4, COS7 cells expressing VGLUT2. In Lane 5, antibodies pre-absorbed with antigenic polypeptide (2 mg) were used.

Expression of VGLUT1 and VGLUT2
Rat VGLUT2 cDNA, as previously described (Aihara et al. 2000 Down), was subcloned into the EcoRI site of expression vector pcDNA3.1 (Invitrogen; San Diego, CA). The resultant construct, VGLUT2–pcDNA3.1, was used to transfect COS7 cells by lipofection using Trans IT reagent (Mirus; Madison, WI). The expression vector for VGLUT1, VGLUT1–pcDNA3.1, was kindly supplied by Drs. S. Takamori and R. Jahn of Göttingen University (Germany). The COS7 cells were grown in DMEM containing 10% fetal calf serum, penicillin, and streptomycin in a humidified incubator at 37C with 5% CO2. After incubation for 24 hr in 10-cm dishes, VGLUT1–pcDNA3.1, VGLUT2–pcDNA3.1, or the pcDNA3.1 vector alone was transfected into COS7 cells by adding 12 µg of the plasmid DNA per dish. After further incubation for 48 hr, the cells were rinsed with 10 ml of buffer comprising 20 mM MOPS–Tris (pH 7.0), 0.3 M sucrose, 2 mM Mg-acetate, 4 mM KCl, and protease inhibitors (leupeptin and pepstatin A at 10 µg/ml each), and then disrupted by brief sonication for 30 sec at output 4 with a Tomy Ultrasonic Disruptor UD-200. Then the mixture was centrifuged at 10,000 x g for 5 min and the resultant supernatant was centrifuged at 266,000 x g for 30 min in a Beckman Optima TLX ultracentrifuge. The precipitate was suspended in the same buffer, and used for Western analysis.

Specimens, Immunohistochemistry, and Immunoelectron Microscopy
Indirect immunofluorescence microscopy was performed as described previously, using an Olympus FV-300 confocal laser microscope (Hayashi et al. 2001 Down, Hayashi et al. 2003 Down). For immunoelectron microscopy, the LR White embedding immunogold method was used (Hayashi et al. 2003 Down). Rats were anesthetized with ether and then perfused intracardially with saline, followed by 0.2% glutaraldehyde and 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). Then each pancreas or testis was cut into small pieces, washed with 0.1 M cacodylate buffer (pH 7.4), stained with uranyl acetate for 2 hr, dehydrated, and then embedded in LR White for 2 days at -20C. Ultrathin sections on nickel grids were incubated with PBS containing 2% goat serum and 0.5% bovine serum albumin for 15 min, and then treated with either antibodies against VGLUT2 (diluted 1:50) or a mixture of antibodies against VGLUT2 (diluted 1:50) and pancreatic polypeptide (diluted 1:200) for 30 min. The sections were washed and treated with the secondary antibodies conjugated with colloidal gold. The sections were washed with 0.1 M cacodylate buffer, postfixed with 5% glutaraldehyde, stained sequentially with uranyl acetate for 30 min and lead citrate for 1 min, and observed under a Hitachi H-7100S electron microscope.

RT-PCR and Northern Analysis
Total RNA extracted from brain, islet of Langerhans, testis, and other tissues (1 µg) was transcribed into cDNA as described previously (Hayashi et al. 2001 Down, Hayashi et al. 2003 Down). For PCR amplification, the 100-fold diluted synthesized cDNA solution was added to the reaction buffer containing 0.12 µM dNTPs (30 µM each dNTP), 25 pmole of primers, and 1.5 U of Gold Taq DNA polymerase (PE Biosystems; Urayasu, Japan). In the case of VGLUT1, the following primers were used: sense primer, AGTGAAATGGAAGACGAGGTT (1687–1717); antisense primer, TTCGGCACGAGCTTGAAACT (2002–2022) (GenBank no. U07609) (Ni et al. 1994 Down). In the case of VGLUT2, the following primers were used; sense primer 2, AACACATCAACCAAGCAAGTC (2304–2324); antisense primer, AGGTAGTGAATGGGAGAGCA (2896–2915) (GenBank no. AF271235) (Aihara et al. 2000 Down). Thirty temperature cycles were conducted as follows: denaturation at 94C for 30 sec, annealing at 58C for 30 sec, and extension at 72C for 1 min. In the case of KA1 and GluR5, the primers used and conditions for amplification were described previously (Yatsushiro et al. 2000 Down), which were ATGACAAGACAGCTACTATC (703–722) as a sense primer and CCATTCCTGGTGAACTGTAA (1212–1231) as an antisense primer for KA1 (Werner et al. 1991 Down), and GGTCCTCTATTACAACTGGA (523–544) as a sense primer and ATGCCATCCAGAAGACCAGT (959–978) as an antisense primer for GluR5 (Bettler et al. 1990 Down). The amplification products were finally analyzed by polyacrylamide gel electrophoresis. DNA sequencing was performed by the chain-termination method (Sambrook et al. 1989 Down). For Northern analysis, mRNA (25 µg) was purified with an OligoTex-dT30 Super mRNA purification kit (Takara; Kusatsu, Japan) from total RNA (500 µg) isolated from testis or other tissues. The mRNAs (5.0 µg per lane) were separated on a formaldehyde agarose gel (1%) and then transferred to a nylon membrane (Amersham). The immobilized RNA was probed with cDNA fragments of VGLUT1 (bases 1687–2022), VGLUT2 (bases 2304–2915), KA1 (bases 703–1231), and GluR5 (bases 523–978), and labeled with [32P]-dCTP (3000 Ci/mmol; Amersham) random priming. After extensive washing, the membrane was subjected to autoradiography using BAS 1000 film (Fuji Film; Fuji, Japan).

Other Procedures
Crude synaptic vesicles were prepared as described (Hayashi et al. 2001 Down). Islets of Langerhans were isolated from male Wistar rats at 7–8 postnatal weeks by the collagenase digestion method combined with discontinuous Ficoll gradient centrifugation (Gotoh et al. 1987 Down). A membrane fraction of islets of Langerhans or testes was prepared as follows: 500 islets or 2 testes were homogenized with a Dounce homogenizer in 20 mM MOPS–Tris (pH. 7.5) containing 0.3 M sucrose, 5 mM EDTA, 5 µg/ml pepstatin A, 5 µg/ml leupeptin, 5 µg/ml chymostatin, and 5 µg/ml antipain. After removing nuclei and unbroken cells by centrifugation at 3000 x g for 8 min, the supernatant was centrifuged at 100,000 x g for 40 min and the resultant pellet was washed twice, suspended in the same buffer, and finally dissociated with the sample buffer containing 10% SDS and 10% ß-mercaptoethanol. Western blotting was performed as described previously (Hayashi et al. 2001 Down).


*   Results
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Specific Antibodies to VGLUT1 and VGLUT2
In this study we used site-specific polyclonal antibodies against VGLUT1 and VGLUT2, which were prepared using GST-fusion proteins containing the carboxyl terminals of these transporters. The regions used for the antibodies are different from each other (Ni et al. 1994 Down; Aihara et al. 2000 Down). The VGLUT1 antibodies recognized a single polypeptide of ~62 kD in brain membranes (Fig 1A, Lane 1) and VGLUT1-expressing COS7 cell membranes (Fig 1A, Lane 3), but not any polypeptide in the membrane fraction prepared from COS7 cells (control vector) (Fig 1A, Lane 2) or VGLUT2-expressing COS7 cells (Fig 1A, Lane 4). The immunoreactivity was blocked when the nitrocellulose sheet was treated with the antigenic peptide used for the preparation of anti-VGLUT1 antibodies during immunostaining (Fig 1A, Lane 5). Conversely, antibodies against VGLUT2 specifically reacted with a 67-kD polypeptide in synaptic vesicle membranes and VGLUT2-expressing COS7 membranes (Fig 1B, Lanes 1 and 2). No crossreactivity was observed in control COS7 membranes (Fig 1B, Lane 3) or VGLUT-1-expressing COS7 membranes (Fig 1B, Lane 4). The immunoreactivity was blocked when the nitrocellulose sheet was treated with the antigenic peptide used for the preparation of anti-VGLUT2 antibodies during immunostaining (Fig 1B, Lane 5). These results indicated that these antibodies specifically recognized VGLUT1 and VGLUT2, respectively.

Expression and Localization of VGLUTs in the Gastroenteropancreatic System
We explored the expression of VGLUT1 and VGLUT2 in peripheral tissues by indirect immunofluorescence microscopy and immunoelectron microscopy, and found that the major sites of VGLUT1 and VGLUT2 expression were in the gastroenteropancreatic system (see below).

Islets of Langerhans. It is unknown whether VGLUT1 is expressed in pancreatic polypeptide-containing F-cells. F-cells account for 5–6% of islet cells. Double-labeling indirect immunofluorescence microscopy clearly indicated that essentially all pancreatic polypeptide-containing cells express VGLUT1 immunoreactivity, indicating that F-cells express VGLUT1 (Fig 2). Double-labeling immunoelectron microscopy indicated that gold particles for VGLUT1 and VGLUT2 (arrowheads) were localized with pancreatic polypeptide-containing secretory granules in F-cells (Fig 3A and Fig 3B). Quantitatively, the labeling densities for VGLUT1 in pancreatic polypeptide-containing secretory granules and other areas, including the cytoplasm and nuclei of F-cells, were 4.5 ± 0.2 and 0.02 ± 0.01 (number of immunogold particles/µm2; four independent experiments), respectively. The labeling densities for VGLUT2 in pancreatic polypeptide-containing secretory granules and other areas, including the cytoplasm and nuclei, were 3.6 ± 0.2 and 0.03 ± 0.01 (number of immunogold particles/µm2; four independent experiments), respectively. Double-labeling immunoelectron microscopy also indicated essentially no labeling of VGLUT1 or VGLUT2 and pancreatic polypeptide in ß-cells (Fig 3C) and {delta}-cells (data not shown). Therefore, both VGLUT1 and VGLUT2 are constituents of pancreatic polypeptide-containing secretory granules in F-cells.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 2. Indirect immunofluorescence microscopy revealed that VGLUT1 and VGLUT2 are associated with pancreatic polypeptide-containing secretory granules in F-cells of islets of Langerhans. Sections of pancreas were doubly immunostained with antibodies against VGLUT1 (green) and pancreatic polypeptide (red) and then observed under a confocal microscope. A merged picture is also shown. Bar = 10 µm.



View larger version (120K):
[in this window]
[in a new window]
 
Figure 3. (A) Double immunoelectron microscopy revealed that immunogold particles for VGLUT1 (15 nm) and pancreatic polypeptide (5 nm) are co-localized with secretory granules. (B) Double immunoelectron microscopy revealed that immunogold particles for VGLUT2 (15 nm) (arrowheads) and pancreatic polypeptide (5 nm) (arrows) are also associated with secretory granules. (C) Double immunoelectron microscopy revealed essentially no immunogold particles for pancreatic polypeptide and VGLUT2 in ß-cells.

Stomach and Small Intestine. In stomach, no VGLUT1 immunoreactivity was detected, whereas VGLUT2-positive cells were identified in the stomach mucosa, especially in the antrum and pylorus. Double-labeling immunohistochemistry indicated that VGLUT2-positive cells coincided with pancreatic polypeptide. Among 50 pancreatic polypeptide-containing cells tested, 31 cells (62%) expressed VGLUT2. Because pancreatic polypeptide and VGLUT2 are co-distributed throughout the cells, VGLUT2 appears to be associated with pancreatic polypeptide-containing secretory granules, as in the case of islet F-cells. In contrast, VGLUT2-positive cells did not coincide with glucagon-, somatostatin-, or serotonin-containing cells, obtained from more than 100 cells each (Fig 4). Gastrin-containing cells (G-cells) did not contain VGLUT2, obtained from more than 200 cells (Fig 4). The pre-absorbed antibodies failed to immunostain any cells (Fig 4).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. VGLUT2 is co-localized with pancreatic polypeptide in stomach mucosa. Sections of stomach were doubly immunostained with antibodies against VGLUT2 (green) and pancreatic polypeptide (red), VGLUT2 (green) and glucagon (red), VGLUT2 (green) and serotonin (red), and VGLUT2 (green) and somatostatin (red), and then observed under a confocal microscope. Merged pictures are also shown. For gastrin (G)-cells, consecutive stomach sections were immunostained for gastrin (green) and VGLUT2 (green), respectively. Preabsorbed VGLUT2 antibodies did not immunostain pancreatic polypeptide-containing cells (preabsorbed). Bars = 10 µm.

As in the case of stomach, no VGLUT1 immunoreactivity was detected in the small intestine (data not shown). On the other hand, VGLUT2 immunoreactivity was frequently observed in the ileum. Fig 5 indicates that the VGLUT2 immunoractivity is always co-localized with that of glucagon, which was obtained from 80 cells. Preabsorbed VGLUT2 antibodies failed to immunostain glucagon-containing cells (data not shown). In contrast to islets of Langerhans and stomach, pancreatic polypeptide-containing cells (33 cells observed) did not contain any immunoreactivity for VGLUT2. Serotonin-containing cells (more than 100 cells) also did not contain any immunoreactivity for VGLUT2. Among enteroendocrine cells, L-cells showed glucagon immunoreactivity (Solcia et al. 1987 Down). Proglucagon is processed to glicentin in L cells (Holst 1997 Down). Pancreatic polypeptide-like peptide (PYY), which differs from authentic pancreatic polypeptide, was also present in secretory granules in most L-cells (Solcia et al. 1987 Down). Consistently, VGLUT2 immunoreactivity was also co-localized with PYY, which was obtained from 48 cells observed (Fig 5). The VGLUT2-positive cells are located in the mucosal epithelium region near muscles and show a morphology distinct from the enteric neurons, and do not coincide with VAchT and synaptophysin, markers of glutamatergic enteric neurons (Tong et al. 2001 Down) (Fig 6). Considering these findings, we concluded that the VGLUT2-expressing cells are L-cells. Co-association of VGLUT2 with glucagon and PYY with particles suggests that VGLUT2 is associated with glicentin-containing secretory granules in these cells, as in the case of glucagon-containing secretory granules in islet {alpha}-cells.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. VGLUT2 is expressed in L-cells in the mucosa of ileum. Sections of ileum were doubly immunostained with antibodies against VGLUT2 (green) and glucagon (red), VGLUT2 (green) and PYY (red), VGLUT2 (green) and serotonin (red), and VGLUT2 and pancreatic polypeptide (PP) (red). Merged pictures are also shown.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 6. Low-power views of sections of ileum doubly immunostained with antibodies against VGLUT2 (green) and vesicular acetylcholine transporter (red), and VGLUT2 (green) and synaptophysin (red). The specimens were observed under a confocal microscope. Merged pictures are also shown. VGLUT2-containing endocrine cells are indicated by arrows. Enteric neurons expressing vesicular acetylcholine transporter (VAchT) are indicated by arrowheads. Bars = 10 µm.

Figure 7. VGLUT2 is expressed in testicular spermatids. (A) Cross-section of testis observed under a Nomarski microscope to reveal various types of cells. (B) Section of testis was immunostained with antibodies against VGLUT2. (C) Section of testis was immunostained with antibodies against VGLUT2 antibodies preabsorbed with antigenic polypeptide (2 mg). Lyd, Leydig cell; spg, spermatogonium; spc, spermatocyte; spm, spermatid. Bar = 10 µm.

Expression and Localization of VGLUT2 in Testis
Mammalian testes consist of many seminiferous tubules, in which the epithelial cells called Sertoli cells anchor and provide nourishment for the developing spermatozoa. The germ stem cells in each tubule reside at the tubule periphery and give rise to proliferating spermatogonial cells. Only the primitive spermatogonia undergo a series of synchronous cell divisions and differentiation, leading to mature sperm (see Fig 7). Immunohistochemical evidence suggests that the immunoreactivity for NMDAR1, GluR2/3 or mGluR2/3 antibodies is distributed in various sites, including the sperm heads of spermatids and spermatozoa (Gill et al. 2000 Down), and that for mGluR5 and mGluR1 antibodies is found inside semiferous tubules and in mature spermatozoa, respectively (Storto et al. 2001 Down). These observations prompted us to explore the expression of VGLUTs in testis.

RT-PCR and Northen blotting analysis clearly indicated the presence of a VGLUT2 gene transcript in testis (Fig 8), while the level of transcription of the VGLUT1 gene was below the detection limit of our assay (not shown). Western blotting analysis indicated the presence of VGLUT2 protein in the particulate fraction of testis (Fig 8). These results indicated the expression and localization of VGLUT2 in testis. Immunohistochemistry indicated that VGLUT2 immunoreactivity was specifically located in spermatids (Fig 7). This immunoreactivity disappeared when the antibodies were pre-absorbed with antigenic polypeptide (Fig 7). No VGLUT2 immunoreactivity was observed in primitive spermatogonia or mature sperm. These results indicated that VGLUT2 is expressed in spermatids. Developmentally, the immunoreactivity appears at 3 postnatal weeks, reaches a plateau at 7 weeks, and then gradually decreases, although some immunoreactivity remains even after 1 year. Consistent with the results of RT-PCR and Northern blotting analysis, little immunoreactivity for VGLUT1 was observed throughout a cross-section of testis (data not shown).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 8. Detection of transcript of VGLUT2 gene and VGLUT2 protein in testis. (Left) RT-PCR analysis for detection of transcripts of VGLUT2 in brain (Lane 2) and testis (Lane 3). The PCR product of the expected size is indicated by an arrow. The PCR product was not detected if reverse transcriptase was omitted from the reaction mixture. The apparent molecular mass is also shown (Lane 1). (Center) Northern analysis of the presence of mRNA in brain (Lane 1) and testis (Lane 2), as indicated, followed by probing with the PCR product amplified from VGLUT2, as described in the text. As a loading control, hybridization with probes specific for G3PDH transcripts was performed for the same RNA blots (lower panel). (Right) Western blotting analysis. Membrane fractions of crude synaptic vesicles (Lane 1) and testis (Lane 2) (50 µg of protein each) were solubilized with sample buffer containing 10% SDS and then subjected to 10% SDS-PAGE. Then the proteins were transferred to nitrocellulose sheets. Western blotting was performed using the indicated antibodies and the immunoreactivity was visualized by ECL. The apparent molecular masses are also shown.

More detailed localization of VGLUT2 at the subcellular level was conducted as follows. We found that VGLUT2 immunoreactivity is always closely localized with acrosin, a marker for acrosomal protein in spermatids (Peknicova and Moos 1990 Down), indicating that VGLUT2 is in some way associated with the acrosomal membrane (Fig 9). Consistently, immunoelectron microscopy demonstrated that gold particles for VGLUT2 are associated with the outer acrosomal membrane (Fig 10A, arrows). A lower level of labeling by the VGLUT2 gold particles was observed in the acrosomal membranes of late spermatids (Fig 10B). Furthermore, only background labeling was observed in acrosomes of mature sperm (Fig 10C) compared with the labeling with control IgG (Fig 10D). From these results, we conclude that VGLUT2 is present in the outer acrosomal membrane.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 9. VGLUT2 is localized in the acrosomes. Sections of testis were doubly immunostained with antibodies against VGLUT2 (green) and acrosin (red) and then observed under a confocal microscope. The boxed area was enlarged. A merged picture is also shown. Note that the immunologically positive areas for VGLUT2 and acrosin do not completely match each other. Bars = 10 µm.



View larger version (120K):
[in this window]
[in a new window]
 
Figure 10. Immunoelectron microscopy revealed the localization of VGLUT2 with the outer acrosomal membrane in spermatids (A). Gold particles for VGLUT2 are indicated by arrows. A smaller amount of gold particles for VGLUT2 was observed in late acrosomes (arrows) (B). Only background labeling of gold particles for VGLUT2 was observed in mature acrosomes (C) or when control IgG was used for spermatids (D). A, acrosome; N, nucleus. Bars = 1 µm.

The presence of VGLUT2 in the outer acrosomal membrane suggests that the acrosome is the site of L-glutamate accumulation. To reveal the glutamatergic system in spermatids in more detail, we investigated the expression and localization of glutamate receptors. Among various ionotropic glutamate receptors examined, we detected the expression of mRNA of KA1 and GluR5 on RT-PCR as well as Northern analysis (Fig 11A and Fig 11B). Immunohistochemistry indicated that both KA1 and GluR5 are co-localized, suggesting the formation of a functional holoreceptor complex (Fig 12), as in the case of the kainate receptor in neurons (Herb et al. 1992 Down; Sakimura et al. 1992 Down). Interestingly, in spermatids, KA1 and GluR5 appear to be associated with the inner acrosomal cup structure facing the nucleus, a countersite for the presence of VGLUT2 (Fig 12 and Fig 13, upper panels). The localizations of KA1 and GluR5 seem to be elongated along with the acrosome in late spermatids, and remain in mature sperm (Fig 12 and Fig 13, lower panels), whereas VGLUT2 immunoreactivity is associated with the center of the acrosome (Fig 13, lower panel). Taken together, these findings strongly suggest that the acrosome is the site of occurrence and reception of L-glutamate signal and that L-glutamate signaling may change during spermatogenesis.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 11. Expression and localization of KA1 and GluR5 glutamate receptors in testis. (A) RT-PCR detection of transcripts of KA1 and GluR5 in brain (Lane 1) and testis (Lane 2). The expected size of each PCR product is indicated. PCR product was not detected if reverse transcriptase was omitted from the reaction mixture. (B) Detection of KA1 and GluR5 mRNA by Northern blotting analysis. mRNAs from brain (Lane 1) and testis (Lane 2) were probed with the PCR products amplified from KA1 and GluR5, as described above. As a loading control, hybridization of probes specific for G3PDH transcripts was performed for the same RNA blots (lower panel). Size markers are also included.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 12. Co-localization of KA1 (green) and GluR5 (red) in early spermatids (upper panels) and late spermatids (bottom panels). Note that KA1 and GluR5 are elongated along with acrosomes in late spermatids and mature sperm. Bars = 10 µm.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 13. Immunohistochemical localization of KA1 and VGLUT2. Sections of testis were doubly immunostained with antibodies against VGLUT2 (red) and KA1 (green) and were observed under a confocal microscope. Merged pictures are also shown. Bars = 10 µm.


*   Discussion
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

VGLUT confers the glutamatergic phenotype on neurons and some endocrine cells. Either VGLUT1 or VGLUT2 or both are expressed in almost all glutamatergic neurons. Although VGLUTs are greatly homologous to each other, their primary amino acid sequences exhibit 90% identity, the properties of the transporters, e.g. substrate specificity, chloride anion-sensitivity, and driving force, are almost identical (Bellocchio et al. 2000 Down; Takamori et al. 2000 Down, Takamori et al. 2001 Down, Takamori et al. 2002 Down; Fremeau et al. 2001 Down; Hayashi et al. 2001 Down; Kaneko and Fujiyama 2002 Down; Varoqui et al. 2002 Down). Recent results from our laboratory constituted the evidence for the functional occurrence of VGLUT1 and VGLUT in peripheral tissues. To completely characterize peripheral glutamatergic systems, in the present study we explored the expression and localization of VGLUT1 and VGLUT2 in peripheral tissues.

We found that VGLUT1 and VGLUT2 are expressed in the gastroenteropancreatic tract and testis. In pancreas, VGLUT2 is present in glucagon-containing secretory granules in {alpha}-cells (Hayashi et al. 2001 Down, Hayashi et al. 2003 Down) and in pancreatic polypeptide-containing secretory granules in F-cells (Fig 2). VGLUT1 is also expressed and localized in pancreatic polypeptide-containing secretory granules in F-cells (Fig 2) and in glucagon-containing secretory granules in a subset of {alpha}-cells (Hayashi et al. 2003 Down). The localization of VGLUT1 and VGLUT2 in these secretory granules implies that L-glutamate is co-sequestered with glucagon and pancreatic polypeptide in these secretory granules and is co-secreted under low-glucose conditions. In fact, we recently found that low-glucose conditions triggered co-secretion of L-glutamate and glucagon from isolated islets (Hayashi et al. 2003 Down) and from {alpha}TC6, clonal {alpha}-cells (Yamada et al. 2001 Down). Therefore, pancreatic polypeptide may be co-secreted with L-glutamate under low-glucose conditions. The released L-glutamate in turn binds to the glutamate receptors in neighboring islet cells, causing a glutamatergic response. In ß-cells, stimulation of glutamate receptors triggers selective secretion of GABA through the enhanced exocytosis of synapse-like microvesicles (Hayashi et al. 2003 Down). In {alpha}-cells, L-glutamate may act as an autocrine or paracrine signaling molecule, inhibiting exocytosis of glucagon and L-glutamate via a metabotropic receptor (mGluR8) (Tong et al. 2002 Down). Therefore, the glutamatergic system may be involved, at least partly, in a regulatory mechanism for glucagon secretion. The glutamatergic system in islets of Langerhans is the first example of secretory granule-mediated glutamate signal transmission.

Various endocrine cells may receive signals in the GI tract and transmit them to a local target, such as neighboring epithelial cells, subepithelial nerve endings, and smooth muscle fiber. Glicentin may act as an intercellular messenger in paracrine action (Solcia et al. 1987 Down). Glucagon-like peptide also potently inhibits GI secretion and motility, and its physiological functions include mediation of the "ileal brake" effect, which regulates food intake (Holst 1997 Down). Pancreatic polypeptide and its relative, PYY, have an effect similar to that of glucagon (Solcia et al. 1987 Down). We have shown that VGLUT2 is expressed in a subpopulation of pancreatic polypeptide-containing cells in stomach and in glucagon-like immunoreactivity and PYY-containing cells in small intestine, which is obviously different from glutamatergic enteric neurons. The co-localization of VGLUTs with either glucagon, glicentin, pancreatic polypeptide, or PYY supports the possibility that L-glutamate is co-released with these peptides. Thus, as in the case of islets of Langerhans, L-glutamate may regulate endocrine function in the GI tract. Other endocrine cells, such as D-cells and enterochromaffin cells, lack VGLUT, suggesting the absence of L-glutamate secretion in these cells. It is noteworthy that VGLUT2 is present in pancreatic polypeptide-containing cells but not in glucagon-containing cells in stomach, wheras VGLUT2 is present in glucagon and PYY-containing cells but not in pancreatic polypeptide-containing cells in small intestine. The different expression of VGLUT2 suggests the different roles of L-glutamate in cell-to-cell interactions in these organs.

The mode of glutamate signal output can be classified into two major types, i. e., vesicle-dependent and vesicle-independent processes. The present study, and our or other recent studies, clearly indicated that vesicle-dependent glutamate signal output can be further classified into at least three groups, i.e., exocytosis of synapse vesicles in neurons, exocytosis of synapse-like microvesicles in pinealocytes, and exocytosis of hormone-containing secretory granules. Astrocytes are also known to secrete L-glutamate in a Ca2+-dependent manner (Purpura et al. 1994 Down), although the secretory mechanism in glia has not yet been characterized. The expression and localization of VGLUT2 in testis may reflect unexpected features of glutamatergic signal output systems.

In testis, VGLUT2 is present in the outer surface of the acrosomal membrane. This implies that L-glutamate is accumulated in acrosomes through VGLUT2. Acrosomes are specialized lysosome-like organelles located in the heads of sperm cells that contain a rich store of hydrolytic enzymes, whose activity plays an essential role in fertilization. During progression of the acrosomal reaction, fusion of the plasma membrane and outer acrosomal membrane allows release of the acrosomal contents. After the detachment of these membrane structures, the inner acrosomal membrane covers the heads of sperm. The internal pH is maintained acidic by active entry of protons through vacuolar proton ATPase (Lee et al. 1983 Down; reviewed in Nelson and Harvey 1999 Down; Kawa et al. 2000 Down), which may provide the driving force for the active transport of L-glutamate, leading to its accumulation. Therefore, it is possible that acrosomes store L-glutamate. Because KA1 and GluR5, components of functional kainate receptor, are expressed and co-localized in the outer acrosomal membrane, it is possible that L-glutamate enters through the outer acrosomal membrane and then binds to the kainate receptor at the inner membrane of acrosomes, causing the glutamatergic response. In this hypothesis, L-glutamate may function as an intracellular messenger, and this type of signaling is no longer "paracrine" or "autocrine" but most probably "intracrine," as proposed for the signal transmission of some hormones, including steroid hormones (reviewed in Re 2002 Down).

Alternatively, as to the function of acrosomal L-glutamate, it has been shown that glutamate decarboxylase (GAD), which synthesizes GABA from L-glutamate, is expressed in acrosomes, and that the GABAB receptor is present on the acrosomal membrane (He et al. 2001 Down; Hu and Yan 2002 Down). These proteins involved in the GABAergic systems in testis appear during the maturation of spermatids together with the disappearance of VGLUT2. Therefore, VGLUT2 might be involved in supplying L-glutamate for the synthesis of GABA in acrosomal regions. These possibilities are now under investigation in our laboratory.

Very recently, another VGLUT isoform, VGLUT3, has been identified (Fremeau et al. 2002 Down; Gras et al. 2002 Down; Schafer et al. 2002 Down; Takamori et al. 2002 Down). In central nervous system, VGLUT3 shows more restricted expression and is present in some populations of inhibitory neurons, cholinergic interneurons, monoamine neurons, and glia. VGLUT3 is also expressed in liver and kidney (Fremeau et al. 2002 Down). It is therefore quite likely that VGLUT3 functions as a component of peripheral glutamatergic systems. Further studies, particularly expression and localization of VGLUT3, are required to elucidate the overall features of the peripheral glutamatergic system.

In conclusion, the present work has demonstrated the expression of VGLUT1 and VGLUT2 in the gastroenteropancreatic system and testis. The localization of VGLUT1 and VGLUT2 in secretory granules in the gastroenteropancreatic system suggests a widespread role of L-glutamate as an intercellular messenger. The localization of VGLUT and glutamate receptors in spermatids suggests the role of L-glutamate as an intracellular messenger. We can pressume that the modes of action of L-glutamate signal transmission are much more varied than was previously believed.


*   Footnotes

1 Present address: Department of Cell Biology, Yale University School of Medicine, New Haven, CT 06510. Back
2 Present address: Department of Bioscience, Nagahama Institute of Bioscience and Technology, Shiga, Japan. Back


*   Acknowledgments

Supported in part by grants from the Japanese Ministry of Education, Science and Culture, the NOVARTIS Foundation, grants from the Society for Research on Umami Taste, and the Kazato Research Foundation. M.H. was supported by research fellowships from the Japan Society for the Promotion of Science for Young Scientists.

We wish to thank Prof R. Jahn and Dr S. Takamori (Max Planck Institute, Germany) for providing us with the cDNA for VGLUT1. We are also grateful to Drs M. Otsuka, Y. Yatsushiro, and S. Ishio for their help in the initial stages of the study.

Received for publication February 25, 2003; accepted May 22, 2003.


*   Literature Cited
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Aihara Y, Mashima H, Onda H, Hisano S, Kasuya H, Hori T, Yamada S et al. (2000) Molecular cloning of a novel brain-type Na+-dependent inorganic phosphate cotransporter. J Neurochem 74:2622-2625[Medline]

Bai L, Xu H, Collins JF, Ghishan FK (2001) Molecular and functional analysis of a novel neuronal glutamate transporter. J Biol Chem 276:36764-36769[Abstract/Free Full Text]

Bai L, Zhang X, Ghishan FX (2003) Characterization of vesicular glutamate transporters in pancreatic alpha- and beta-cells and its regulation by glucose. Am J Physiol 284:G808-814

Bellocchio EE, Reimer RJ, Fremeau RT, Jr, Edwards RH (2000) Uptake of glutamate by an inorganic phosphate transporter. Science 289:957-960[Abstract/Free Full Text]

Bettler B, Boulter J, Hermans–Borgmeyer I, O'Shea–Greenfield A, Deneris ES, Moll C, Borgmeyer U et al. (1990) Cloning of a novel glutamate receptor subunit, GluR5: expression in the nervous system during development. Neuron 5:583-595[Medline]

Foster A, Fagg G (1984) Acidic amino acids binding sites in mammalian neuronal membranes: their characteristics and relationship to synaptic receptors. Brain Res 319:103-164[Medline]

Fremeau RT, Burman J, Qureshi T, Tran CH, Proctor J, Johnson J, Zhang H et al. (2002) The identification of vesicular glutamate transporter 3 suggests a novel model of signaling by glutamate. Proc Natl Acad Sci USA 99:14488-14493[Abstract/Free Full Text]

Fremeau RT, Troyer MD, Pahner I, Nygaard GO, Tran CH, Reimer RJ, Bellocchio EE et al. (2001) The expression of vesicular glutamate transporters defines two classes of excitatory synapses. Neuron 31:247-260[Medline]

Gill SS, Mueller RW, McGuire PF, Pulido OM (2000) Potential target sites in peripheral tissues for excitatory neurotransmission and excitotoxicity. Toxicol Pathol 28:277-284[Abstract/Free Full Text]

Gotoh M, Maki T, Satomi S, Porter J, Bonner-Weir S, O'Hara CJ, Monaco AP (1987) Reproducible high yield preparation of rat islets by stationary in vitro digestion following pancreatic ductal or portal venous collagenase injection. Transplantation 43:725-730[Medline]

Gras C, Herzog E, Bellenci GC, Bernard V, Ravassard P, Pohl M, Gasnier B et al. (2002) A third vesicular glutamate transporter expressed by cholinergic and serotonergic neurons. J Neurosci 22:5442-5451[Abstract/Free Full Text]

Hayashi M, Otsuka M, Morimoto R, Hirota S, Yatsushiro S, Takeda J, Yamamoto A et al. (2001) Differentiation-associated Na+-dependent inorganic phosphate cotransporter (DNPI) is a vesicular glutamate transporter in endocrine glutamatergic systems. J Biol Chem 276:43400-43406[Abstract/Free Full Text]

Hayashi M, Yamada H, Uehara S, Morimoto R, Muroyama A, Takeda J, Yamamoto A et al. (2003) Secretory-granule-mediated co-secretion of L-glutamate and glucagon triggers the glutamatergic chemical transmission in the islet of Langerhans. J Biol Chem 278:1966-1974[Abstract/Free Full Text]

He XB, Hu JH, Wu Q, Yan SS, Koide SS (2001) Identification of GABA(B) receptor in rat testis and sperm. Biochem Biophys Res Commun 283:243-247[Medline]

Herb A, Burnashev N, Werner P, Sakmann B, Wisden W, Seeburg PH (1992) The KA-2 subunit of excitatory amino acid receptors shows widespread expression in brain and forms ion channels with distinctly related subunits. Neuron 8:775-785[Medline]

Herzog E, Bellenchi GC, Gras C, Bernard V, Ravassard P, Bedet C, Gasnier B et al. (2001) The existence of a second vesicular glutamate transporter specifies subpopulations of glutamatergic neurons. J Neurosci 21:RC181[Abstract/Free Full Text]

Holst JJ (1997) Enteroglucagon. Annu Rev Physiol 59:257-271[Medline]

Hu JH, Yan YC (2002) Identification of {gamma} subunit of GABAA receptor in rat testis. Cell Res 12:33-37[Medline]

Kaneko T, Fujiyama F (2002) Complementary distribution of vesicular glutamate transporters in the central nervous system. Neurosci Res 42:243-250[Medline]

Kawa G, Yamamoto A, Yoshimori T, Muguruma K, Matsuda T, Moriyama Y (2000) Immunohistochemical localization of V-ATPases in rat spermatids. Int J Androl 23:278-283[Medline]

Lee HC, Johnson C, Epel D (1983) Changes in internal pH associated with initiation of motility and acrosome reaction of sea urchin sperm. Dev Biol 95:31-45[Medline]

Mayer ML, Westbrook G (1987) The physiology of excitatory amino acids in the vertebrate central nervous system. Prog Neurobiol 28:197-276[Medline]

Morimoto R, Hayashi M, Yatsushiro S, Otsuka M, Yamamoto A, Moriyama Y (2003) Co-expression of vesicular glutamate transporters (VGLUT1 and VGLUT2) and their association with synaptic-like microvesicles in rat pinealocytes. J Neurochem 84:382-391[Medline]

Moriyama Y, Hayashi M, Yamada H, Yatsushiro S, Ishio S, Yamamoto A (2000) Synaptic-like microvesicles, synaptic vesicle counterparts in endocrine cells, are involved in a novel regulatory mechanism for hormonal synthesis and secretion. J Exp Biol 203:117-125[Abstract]

Nelson N, Harvey WR (1999) Vacuolar and plasma membrane proton adenosintriphosphatases. Physiol Rev 79:361-385[Abstract/Free Full Text]

Ni B, Rosteck PR, Jr, Nadi NS, Paul SM (1994) Cloning and expression of a cDNA encoding a brain-specific Na+-dependent Pi cotransporter. Proc Natl Acad Sci USA 91:5607-5611[Abstract/Free Full Text]

Otis TS (2001) Vesicular glutamate transporters incognito. Neuron 29:11-14[Medline]

Peknicova J, Moos J (1990) Monoclonal antibodies against boar acrosomal antigens labeling undamaged acrosomes of spermatozoa in immunofluorescence test. Andrologia 22:427-435[Medline]

Purpura V, Basaeski TA, Liu F, Jeftinija K, Jeftinija S, Haydon PG (1994) Glutamate-mediated astrocyte-neuron signaling. Nature 369:744-747[Medline]

Re RN (2002) Toward a theory of intracrine hormone action. Regul Pept 106:1-6[Medline]

Sakimura K, Morita T, Kushiya E, Mishima M (1992) Primary structure and expression of the gamma 2 subunit of the glutamate receptor channel selective to kainate. Neuron 8:267-274[Medline]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. 2nd ed Cold Spring Harbor, NY, Cold Spring Harbor Laboratory

Schafer M-H, Varoqui H, Defamie N, Weihe E, Erickson JD (2002) Molecular cloning and functional identification of mouse vesicular glutamate transporter 3 and its expression in subsets of novel excitatory neurons. J Biol Chem 277:50734-50748[Abstract/Free Full Text]

Skerry TM, Genever PG (2001) Glutamate signaling in non-neuronal tissues. Trends Pharmacol Sci 22:174-181[Medline]

Solcia E, Capella C, Buffa R, Usellini L, Fiocca R, Sessa F (1987) Endocrine cells of the digestive system. In Johnson LR, ed. Physiology of the Gastrointestinal Tract. 2nd ed New York, Raven Press, 111-130

Storto M, Sallese M, Salvatore L, Poulet R, Condorelli DF, Dell'Albani P, Marcello MF et al. (2001) Expression of metabotropic glutamate receptors in the rat and human testis. J Endocrinol 170:71-78[Abstract]

Takamori S, Malherbe P, Broger C, Jahn R (2002) Molecular cloning and functional characterization of human vesicular glutamate transporter 3. EMBO Rep 3:798-803[Medline]

Takamori S, Rhee JS, Rosenmund C, Jahn R (2000) Identification of a vesicular glutamate transporter that defines a glutamatergic phenotye in neurons. Nature 407:189-194[Medline]

Takamori S, Rhee JS, Rosenmund C, Jahn R (2001) Identification of differentiation-associated brain-specific phosphate transporter as a second vesicular glutamate transporter (VGLUT2). J Neurosci 15:RC182

Tong Q, Ma J, Kirchgessner AL (2001) Vesicular glutamate transporter 2 in the brain-gut axis. Neuroreport 12:3929-3934[Medline]

Tong Q, Ouedraogo R, Kirchgessner AL (2002) Localization and function of group III metabotropic glutamate receptors in rat pancreatic islets. Am J Physiol 282:E1324-1333

Varoqui H, Schafer MK, Zhu H, Weihe E, Erikson JD (2002) Identification of the differentation-associated Na+/Pi transporter as a novel vesicular glutamate transporter in a distinct set of glutamatergic synapses. J Neurosci 22:142-155[Abstract/Free Full Text]

Werner P, Voigt M, Keinanen K, Wisden W, Seeburg PH (1991) Cloning of a putative high-affinity kainate receptor expressed predominantly in hippocampal CA3 cells. Nature 351:742-744[Medline]

Yamada H, Otsuka M, Hayashi M, Nakatsuka S, Hamaguchi K, Yamamoto A, Moriyama Y (2001) Ca2+-dependent exocytosis of L-glutamate by {alpha}TC6 cells, clonal mouse pancreatic {alpha} cells. Diabetes 50:1012-1020[Abstract/Free Full Text]

Yamada H, Yatsushiro S, Ishio S, Hayashi M, Nishi N, Yamamoto A, Futai M et al. (1998) Metabotropic glutamate receptors negatively regulate melatonin synthesis in rat pinealocytes. J Neurosci 18:2056-2062[Abstract/Free Full Text]

Yatsushiro S, Yamada H, Hayashi M, Yamamoto A, Moriyama Y (2000) Inotropic glutamate receptors trigger microvesicle-mediated exocytosis of L-glutamate in rat pinealocytes. J Neurochem 75:288-297[Medline]

Yatsushiro S, Yamada H, Kozaki S, Kumon H, Michibata H, Yamamoto A, Moriyama Y (1997) L-Aspartate but not D form is secreted through microvesicle-mediated exocytosis and is sequestered through Na+-dependent transporter in rat pinealocytes. J Neurochem 69:340-347[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Toxicol PatholHome page
S. Gill, M. Barker, and O. Pulido
Neuroexcitatory Targets in the Female Reproductive System of the Nonhuman Primate (Macaca fascicularis)
Toxicol Pathol, April 1, 2008; 36(3): 478 - 484.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Hiasa, T. Matsumoto, T. Komatsu, and Y. Moriyama
Wide variety of locations for rodent MATE1, a transporter protein that mediates the final excretion step for toxic organic cations
Am J Physiol Cell Physiol, October 1, 2006; 291(4): C678 - C686.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. C. McGahan, J. Harned, M. Mukunnemkeril, M. Goralska, L. Fleisher, and J. B. Ferrell
Iron alters glutamate secretion by regulating cytosolic aconitase activity
Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1117 - C1124.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. M. Wojcik, J. S. Rhee, E. Herzog, A. Sigler, R. Jahn, S. Takamori, N. Brose, and C. Rosenmund
An essential role for vesicular glutamate transporter 1 (VGLUT1) in postnatal development and control of quantal size
PNAS, May 4, 2004; 101(18): 7158 - 7163.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Y. Moriyama and A. Yamamoto
Glutamatergic Chemical Transmission: Look! Here, There, and Anywhere
J. Biochem., February 1, 2004; 135(2): 155 - 163.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayashi, M.
Right arrow Articles by Moriyama, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayashi, M.
Right arrow Articles by Moriyama, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact