Journal of Histochemistry and Cytochemistry
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Beck, K.
Right arrow Articles by Boyd, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Beck, K.
Right arrow Articles by Boyd, C. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Histochemistry and Cytochemistry, Vol. 51, 887-902, July 2003, Copyright © 2003, The Histochemical Society, Inc.


ARTICLE

The Distribution of Abcc6 in Normal Mouse Tissues Suggests Multiple Functions for this ABC Transporter

Konstanze Becka, Kimiko Hayashia, Brian Nishiguchia, Olivier Le Sauxa, Masando Hayashia, and Charles D. Boyda
a The Pacific Biomedical Research Center, University of Hawai'i, Honolulu, Hawai'i

Correspondence to: Charles D. Boyd, Lab. of Matrix Pathobiology, the Pacific Biomedical Research Center, University of Hawai'i, 1993 East–West Road, Honolulu, HI 96822. E-mail: cbkc08901@aol.com


*   Summary
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

We have studied the tissue distribution of Abcc6, a member of the ABC transmembrane transporter subfamily C, in normal C57BL/6 mice. RNase protection assays revealed that although almost all tissues studied contained detectable levels of the mRNA encoding Abcc6, the highest levels of Abcc6 mRNA were found in the liver. In situ hybridization (ISH) demonstrated abundant Abcc6 mRNA in epithelial cells from a variety of tissues, including hepatic parenchymal cells, bile duct epithelia, kidney proximal tubules, mucosa and gland cells of the stomach, intestine, and colon, squamous epithelium of the tongue, corneal epithelium of the eye, keratinocytes of the skin, and tracheal and bronchial epithelium. Furthermore, we detected Abcc6 mRNA in arterial endothelial cells, smooth muscle cells of the aorta and myocardium, in circulating leukocytes, lymphocytes in the thymus and lymph nodes, and in neurons of the brain, spinal cord, and the specialized neurons of the retina. Immunohistochemical analysis using a polyclonal Abcc6 rabbit antibody confirmed the tissue distribution of Abcc6 suggested by our ISH studies and revealed the cellular localization of Abcc6 in the basolateral plasma membrane in the epithelial cells of proximal convoluted tubules in the kidney. Although the function of Abcc6 is unknown, mutations in the human ABCC6 gene result in a heritable disorder of connective tissue called pseudoxanthoma elasticum (PXE). Our results demonstrating the presence of Abcc6 in epithelial and endothelial cells in a variety of tissues, including those tissues affected in PXE patients, suggest a possible role for Abcc6 in the normal assembly of extracellular matrix components. However, the presence of Abcc6 in neurons and leukocytes, two cell populations not associated with connective tissue, also suggests a more complex multifunctional role for Abcc6. (J Histochem Cytochem 51:887–902, 2003)

Key Words: Abcc6, Mrp6, pseudoxanthoma elasticum, tissue distribution, in situ hybridization, differential polyadenylation


*   Introduction
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

ATP-binding cassette (ABC) proteins transport various substrates across biological membranes in all known organisms. These transmembrane proteins typically consist of two transmembrane domains (TMDs) and two highly conserved nucleotide-binding domains (NBDs) containing Walker A and B motives and a signature C region. In most eukaryotic ABC transporters, these domains are fused together into one polypeptide (Higgins 1992 Down). Thus far, 48 ABC transporters have been identified in humans (Dean et al. 2001 Down) and 34 in mouse (Schriml and Dean 2000 Down).

The subfamily C, also called the CFTR/MRP subfamily for the prominent members CFTR (cystic fibrosis transmembrane conductance regulator or ABCC7) and MRP1 (multidrug resistance-associated protein or ABCC1), consists of 12 genes in humans (Dean et al. 2001 Down) and 11 in mouse (Schriml and Dean 2000 Down). Although some members of this family have been identified as drug resistance proteins, ABCC proteins are all expressed in normal tissues and, in addition to exogenously administered drugs, these ABCC proteins also transport many endogenous substrates (reviewed in Borst et al. 1999 Down; Renes et al. 2000b Down; Kruh et al. 2001 Down; Gottesman et al. 2002 Down). MRP1 is the most extensively studied member of the multidrug resistant proteins of this family. MRP1 is ubiquitously expressed in normal human tissues and in a variety of human cell lines derived from solid tumors in adults (Kruh et al. 1995 Down). MRP1 is localized on the basolateral side of the plasma membrane in polarized cells (Mayer et al. 1995 Down; Evers et al. 1996 Down) and transports anionic conjugates of many toxic compounds and leukotriene C4 (LTC4) (Jedlitschky et al. 1994 Down; Muller et al. 1994 Down; Leier et al. 1996 Down; Loe et al. 1996 Down). It has been suggested that ABCC1, through the capacity of this transporter to export the toxic lipid peroxidation product 4-hydroxynonenal (4HNE), functions as part of the cellular defense system against oxidative stress (Renes et al. 2000a Down).

A spectrum of mutations in the human ABCC6 (MRP6, MOAT-E) gene has been shown to be responsible for pseudoxanthoma elasticum (PXE) (Bergen et al. 2000 Down; Ringpfeil et al. 2000 Down; Struk et al. 2000 Down; Le Saux et al. 2000 Down, Le Saux et al. 2001 Down; Meloni et al. 2001 Down). Patients with PXE accumulate fragmented, calcified elastic fibers and altered collagen fibrils in elastic tissues of the skin, retina, and arterial walls (Uitto and Shamban 1987 Down). Typical skin lesions, characterized by yellowish papules in flexural areas, laxity, and loss of elasticity of the skin, are the most common dermal feature of PXE (Uitto and Shamban 1987 Down; Neldner 1988 Down; Uitto et al. 1998 Down). Calcification of elastic fibers of the Bruch's membrane of the eye, with an associated development of angioid streaks followed by subretinal neovascularization and retinal hemorrhage, can lead to the loss of central vision (Weenink et al. 1996 Down). Calcification of elastic fibers in the elastic laminae of the aorta and other arteries also results in cardiovascular manifestations such as premature peripheral vascular occlusive disease, gastrointestinal bleeding, and intermittent claudication (Mendelsohn et al. 1978 Down; Nishida et al. 1990 Down; Lebwohl et al. 1993 Down).

Mutations in several ABCC genes result in a variety of different heritable disorders. These include mutations in ABCC7 that result in cystic fibrosis (reviewed in Akabas 2000 Down; Ko and Pedersen 2001 Down), in ABCC8 (Sur1) responsible for familial persistent hyperinsulinemic hypoglycemia of infancy (Thomas et al. 1995 Down), and ABCC2 (MRP2, cMOAT), which is mutated in patients with Dubin–Johnson syndrome (Wada et al. 1998 Down). Although the spectrum of phenotypes caused by mutations in ABCC genes is considerable, the development of these disorders is consistent with at least the known function(s) of the respective transporters. In contrast, although the involvement of the skin, the eye, and the arterial system in PXE suggested that perhaps the expression of ABCC6 was limited to these tissues, this is in fact not the case. Indeed, previous studies have detected high levels of ABCC6 mRNA in human kidney and liver and low levels of ABCC6 mRNA in most other human tissues studied (Kool et al. 1999 Down). Real-time PCR analysis demonstrated the presence of ABCC6 mRNA in human jejunum (Taipalensuu et al. 2001 Down) and RT-PCR detected ABCC6 mRNA in the liver, skin, vessel walls, placenta (Bergen et al. 2000 Down), and brain microvessel endothelial cells (Zhang et al. 2000 Down). Immunohistochemistry using a monoclonal antibody against human ABCC6 showed the localization of this transporter in the basolateral membranes in hepatocytes and proximal tubules in the kidney. In this study, ABCC6 could not be detected in other human tissues (Scheffer et al. 2002 Down). Using Northern blotting analysis, a high abundance of rat Abcc6 (mrp6, MLP-1) mRNA has been shown in the liver and lower levels of mRNA were detected in the kidney, small intestine and colon (Madon et al. 2000 Down). The rat Abcc6 protein was predominantly confined to the lateral border of hepatocytes and to a limited extent in the canalicular membrane (Madon et al. 2000 Down).

The abundance of human ABCC6 in kidney and liver and the high levels of Abcc6 mRNA in rat liver have prompted some investigators to suggest that PXE, a disorder in which abnormal renal and/or hepatic function has not been observed, might be a metabolic disease (Uitto et al. 2001 Down). Alternatively, because several studies have suggested a widespread distribution of ABCC6, the lack of a functional ABCC6 could influence extracellular matrix (ECM) assembly in several tissues, particularly those tissues affected in PXE (Ilias et al. 2002 Down). To further investigate this latter hypothesis, we have undertaken to analyze, for the first time, not only the tissue distribution of Abcc6 mRNA but also the distribution of Abcc6 mRNA in different cell types within a wide variety of tissues. This manuscript reports both the tissue and cellular distribution of Abcc6 mRNA in normal adult mouse tissues using both RNase protection experiments and in situ hybridization and the presence of Abcc6 in these tissues using a polyclonal ABCC6 antibody.


*   Materials and Methods
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Animals
Eight-week-old male and female C57BL/6 mice were obtained from Charles River Laboratories (Wilmington, MA). In compliance with NIH regulations, animal handling and experiments using animal tissue were conducted according to an animal use protocol that was approved by the Institutional Animal Care and Use Committee of the University of Hawai'i.

Cloning of ABCC6 cDNAs from Mouse Liver
An 8-week-old male C57BL/6 mouse was sacrificed and the liver was excised and snap-frozen in liquid nitrogen. The frozen tissue was homogenized and resuspended in 1 ml RNA STAT-60 (TEL-TEST; Friendswood, TX) per 100 mg tissue. Total RNA was isolated according to the manufacturer's instructions and cDNA was prepared with Oligo(dT) primer using Superscript first-strand synthesis system for RT-PCR (Invitrogen; Carlsbad, CA). Based on the published murine Abcc6 mRNA sequence (GenBank accession number NM_018795), primers mAbcc6-ex30a (5' TGCGCTCCGTGATGGACTGT 3') and mAbcc6-3'UTRb (5' GTTGTAAAGACGAGTCGGTC 3') were designed to obtain a 586-bp cDNA (Abcc6-3'UTR). A 30-µl PCR reaction mixture contained 1.5 µl liver cDNA, 1 µM each primer, 200 mM dNTPs, 3 µl 10 x buffer and 1.5 µl AmpliTaq DNA polymerase (Applied Biosystems; Foster City, CA). PCR reaction conditions in a 3700 thermocycler (Perkin–Elmer; Wellesley, MA) were as follows: 3 min denaturation at 94C, 35 cycles of 30 sec at 94C, 30 sec at 52C, 1 min at 72C, followed by a 5-min terminal elongation step at 72C. PCR products were purified from a 1.2% TAE agarose gel with Quiaquick gel extraction kit (Qiagen; Hilden, Germany), cloned into pGEM-T easy (Promega; Madison, WI) to yield plasmid pGEM-Abcc6-3'UTR, and transformed into E. coli DH5{alpha}. Plasmid midi preparations were prepared with Midiprep kit (Qiagen). The orientation of the insert was verified by restriction analysis and its sequence verified with BigDyeTerminator (Applied Biosystems) using an ABI310 automated sequencer (Applied Biosystems). Based on published EST data (GenBank accession numbers: AW493424, BF322691, AI507076) and the published Abcc6 mRNA (GenBank accession number NM_018795), nested poly(dT) reverse primers mAbcc6-TC1b (5' TTTTTTTTTTGGAGTTGTAAA 3') and mAbcc6-TC2b (5' TTTTTTTTTTCACAGTTTCTC 3') were designed. These primers were used, in combination with primer mAbcc6-ex30a, to amplify two species of differentially polyadenylated Abcc6 cDNAs. PCR conditions and cloning of a 512-bp probe (Abcc6-3'UTR-TC2) into pGEM-T easy, were performed as described above.

Preparation of 33P-radiolabeled Antisense RNA Probes
One hundred µg of plasmids pGEM-Abcc6-3'UTR and pGEM-Abcc6-3'UTR-TC2 was linearized by digestion with SalI (NEB; Beverly, MA) and gel-purified. To obtain 33P-labeled Abcc6 antisense RNA probes with high specific activity (2 x 109 cpm/µg), in vitro transcriptions were performed with 5 µg linearized plasmid DNA, 2 µl 5 x transcription buffer, 40 U RNasin, 10 mM DTT, 0.5 mM ATP, 0.5 mM GTP, 0.5 mM CTP, 3 µM UTP, 6.4 µl [{alpha}33P]-UTP (3000 Ci/mM, 10 mCi/ml), and 15 U T7 RNA polymerase in a 20-µl reaction using Riboprobe in vitro transcripton systems (Promega). A low specific activity (2 x 107 cpm/µg) GAPDH antisense control probe was transcribed from 5 µg of a linearized construct pTRI-GAPDH mouse (Ambion; Austin, TX) under the same conditions using only 0.05 µl [{alpha}33P]-UTP (3000 Ci/mM, 10 mCi/ml). Transcription was carried out for 1 hr at 37C, followed by digestion with 1 U DNase for 20 min at 37C. Incorporation of [33P]-UTP and the specific activities of the probes were determined and the radiolabeled RNA probes were gel-purified as described in the RPA III ribonuclease protection assay manual (Ambion). Probe sizes were 677 nucleotides for the Abcc6-3'UTR, 603 nucleotides for the Abcc6-3'UTR-TC2, and 403 nucleotides for the GAPDH antisense RNA probes. RNA length standards were synthesized in a similar in vitro transcription reaction using an RNA Century marker template set (Ambion).

RNase Protection Assay
Total RNA was isolated from various tissues of C57BL/6 mice with STAT-60 (TEL-TEST) as described above. RNase protection assays were carried out with RPA IIITM ribonuclease protection assay kit (Ambion) using a standard hybridization procedure described by the manufacturer. We used 40 µg of each total RNA preparation, 0.05 ng Abcc6-3'UTR, and 4 ng GAPDH 33P antisense RNA probes per sample and digested single-stranded RNA with RNase T1, diluted 1:20. RNase-protected fragments were separated on a 6% polyacrylamide, 8 M urea, TBE (45 mM Tris-borate, 1 mM EDTA) sequencing gel. The dried gel was exposed to a low-energy phosphorimager screen (Amersham Biosciences; Sunnyvale, CA) to visualize radiolabeled, size-separated RNA fragments.

RT-PCR on Human Leukocyte RNA
Total RNA was isolated from whole blood from two healthy individuals using the QIAamp RNA blood mini kit (Qiagen). cDNA was prepared from 0.4 µg total RNA with the Superscript first-strand synthesis system for RT-PCR (Invitrogen) using random hexamer primers. The mRNA sequence enclosed within exons 25–26 of human ABCC1 was PCR-amplified during 35 cycles of a standard PCR reaction as described previously (Le Saux et al. 2000 Down). Primers ABCC6ex23a (5' GGAGACAGACACGGTTGACG 3') and ABCC6ex26b (5' AGGTCTGTCCAGTTGCGAAC 3') allowed amplification of ABCC6 mRNA encoded within exons 23 to 26.

Preparation of DIG-labeled Sense and Antisense RNA Probes
A DIG RNA labeling kit (SP6/T7) (Roche; Mannheim, Germany) was used to prepare DIG-labeled Abcc6 RNA probes. SalI-digested plasmid pGEM-Abcc6-3'UTR was transcribed in vitro with T7 RNA polymerase to yield digoxigenin-labeled Abcc6 antisense probe. To obtain Abcc6 sense RNA probe, the same plasmid was digested with NcoI and was transcribed in vitro using SP6 RNA polymerase. To reduce the lengths of the probes to about 250 nucleotides, the RNA probes were then subjected to alkaline hydrolysis. DIG incorporation was determined using a DIG nucleic acid detection kit (Roche).

Western Blotting Analysis
Liver extracts and plasma membranes were prepared as described (Meier et al. 1984 Down), with some modifications. Preparation and properties of the polyclonal antibody used in this study have been reported elsewhere (Ilias et al. 2002 Down). Isolated plasma membrane vesicles from Sf9 insect cells overexpressing human ABCC6 were a generous gift from Dr. Varadi (Ilias et al. 2002 Down). Preparations of total extract, S1 supernatant, P1 pellet, and plasma membranes from mouse liver and plasma membranes from Sf9 cells were separated on a 6–15% SDS gradient PAGE and transferred onto Immobilon-P transfer membranes (Millipore; Bedford, MA) in 0.037% SDS, 20% methanol, 39 mM glycine, 48 mM Tris base transfer buffer for 2.5 hr at 1 mA/cm2. The membrane was blocked in 5% low-fat milk in 0.1% Tween-20, TBS (20 mM Tris, 150 mM NaCl, pH 7.5) overnight, washed three times for 10 min in 0.1% Tween-20, TBS (TTBS), decorated with the affinity-purified polyclonal antibody HB-6 diluted 1:3000 in 5% milk, TTBS for 1 hr, washed again three times for 10 min in TTBS, decorated with horseradish peroxidase-coupled anti-rabbit antibodies (Amersham Biosciences) diluted 1:5000 in 5% milk, TTBS, washed as above, and developed with ECL (Amersham Biosciences). For the peptide-blocking assay, a 50-fold molar excess of HB-6 peptide was added to the solution containing the polyclonal antibody HB-6.

In Situ Hybridization
Male and female C57BL/6 mice were sacrificed by cervical dislocation. Tissues to be examined were obtained from 8-week-old male and female C57BL/6 mice and fixed overnight at room temperature in 4% formaldehyde in PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4) prepared with DEPC-treated water. Tissues were washed in PBS and dehydrated in a graded series of ethanol. Tissues were then cleared in xylenes and embedded in paraffin. Sections were cut at 5 µm, mounted on silane-coated slides, and deparaffinized by heating at 60C for 1 hr in a dry Caplin jar, followed by three changes of xylene, each for 15 min, and rehydrated through a graded series of ethanol and rinsed in DEPC-treated water. The slides were incubated for 30 min at 37C with 5 µg/ml RNase-free proteinase K dissolved in TE buffer (100 mM Tris-HCl, 50 mM EDTA, pH 8.0). Proteinase K digestion was terminated by incubation for 5 min in 0.2% glycine in PBS. Sections were postfixed for 10 min in 4% formaldehyde in PBS and washed twice with PBS for 5 min each. The slides were then transferred to 0.1 M triethanolamine-HCl, pH 8.0. Acetic anhydride was added to a final concentration of 0.5% (v/v) and incubated for 10 min with gentle stirring. Slides were rinsed for 1 min in PBS, dehydrated through a graded series of ethanol, and finally air-dried.

Sections were prehybridized for 1 hr at 37C with 150 µl hybridization solution without probe and then hybridized overnight at 70C with 50 µl hybridization solution. Hybridization solution contained 50% deionized formamide, 10% dextran sulfate, 4 x SSC (0.6 M NaCl, 60 mM sodium citrate, pH 7.2), 1 mg/ml yeast tRNA, 1 x Denhardt's solution (0.02% Ficoll, 0.02% polyvinylpyrrolidone, 10 mg/ml RNase-free BSA), 1 mg/ml denatured salmon sperm DNA, and 1 ng/µl digoxigenin-labeled RNA probe. During hybridization, sections were covered with autoclaved plastic Gel Bond Film cover slips (FMC BioProducts; Rockland, ME) and incubated with the hybridization solution in a moist chamber saturated with 4 x SSC. The slides were washed twice with 2 x SSC for 30 min at 50C and twice with NTE buffer (0.5 M NaCl, 10 mM Tris, 1 mM EDTA, pH 8.0) for 5 min at 37C and then incubated for 30 min with 20 µg/ml RNase A in NTE buffer at 37C. After washing twice for 5 min each with NTE buffer at 37C, 30 min in 2 x SSC at 50C, 5 min at RT in 1 x SSC, and twice for 10 min in buffer 1 (0.15 M NaCl, 0.1 M Tris-HCl, pH 7.5), the sections were blocked for 30 min with 2% normal sheep serum, 0.1% Triton X-100 in buffer 1 in a humid chamber. After a 2-hr incubation with anti–digoxigenin–AP Fab fragments (Roche) diluted 1:500 in buffer 1 with 1% normal sheep serum and 0.1% Triton X-100, the slides were washed three times with buffer 1 containing 0.1% Tween-20 and equilibrated for 10 min in buffer 2 (0.1 M NaCl, 0.1 M Tris-HCl, pH 9.5). Color detection was carried out overnight with detection buffer [200 µl buffer 2, 4 µl NBT/BCIP (DIG nucleic acid detection kit; Roche), 1 µl 1 M levamisole (Sigma; St Louis, MO), 10 µl 1 M MgCl2)]. After rinsing in buffer 3 (1 mM EDTA, 10 mM Tris-HCl, pH 8.1) and twice in H2O, the sections were mounted with Mount Quick Aqueous (Research Products International; Palatine, IL).

Immunohistochemistry
Procedures for immunostaining using the unlabeled antibody peroxidase–anti-peroxidase technique (Sternberger et al. 1970 Down) were carried out as described previously (Hayashi et al. 1987 Down). Sections from formaldehyde-fixed, paraffin-embedded tissues were deparaffinized as described above. These sections were then treated with 1% hydrogen peroxide in methanol for 30 min, washed, and covered with 5% normal goat serum in 0.1 M PBS for 30 min. Sections were incubated with the primary antibody in 1 mg/ml BSA in PBS overnight at 4C, then with goat anti-rabbit IgG (Sigma) at 50 µg/ml dilution for 30 min and rabbit peroxidase–antiperoxidase (Sigma) diluted at 50 µg/ml for 30 min at RT. The sites of antibody binding were visualized by immersing the slides in 0.05% diaminobenzidine (Sigma) in 0.05 M Tris-HCl buffer, pH 7.6, and 0.01% hydrogen peroxide for 5 min. The sections were counterstained with Harris hematoxylin. Negative controls were incubated in the medium containing pre-immune serum and were processed in the same manner as above.


*   Results
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Two Species of Abcc6 mRNA Detected by RNase Protection
To determine the levels of Abcc6 mRNA in different tissues, we performed an RNase protection assay (RPA). High amounts of human ABCC6 and rat Abcc6 mRNA have been detected in the liver (Kool et al. 1999 Down; Madon et al. 2000 Down). Therefore, to obtain an RNA probe complementary to Abcc6 mRNA, we isolated RNA from mouse liver, prepared cDNA, and amplified the 3'end of the mouse Abcc6 cDNA using primers mAbcc6-ex30a and mAbcc6-3'UTRb. These primers allowed amplification of a 586-bp fragment at the 3' end of the mouse Abcc6 cDNA, starting at bp 4364 in exon 30 including exon 31 and extending 453 bp into the 3'UTR (Fig 1A). The PCR product was cloned into a plasmid suitable for in vitro transcription of insert cDNA. Insert DNA was sequenced and compared to the published Abcc6 mRNA identified in mouse liver (GenBank accession number NM_018795, from mouse strain DDY). We found three differences between our mouse sequences and the published mRNA sequence for mouse Abc6: 4510A>T and 4703T>C, both in the 3'UTR, and 4430A>G in exon 31 that resulted in a N1477S amino acid substitution. In human ABCC6 and in other ABCC proteins, the amino acid at position 1477 is a serine. We therefore considered N1477S to be a neutral polymorphism found in the mouse strain C57BL/6. The Abcc6 genomic DNA sequence of mouse strain C57BL/6 published by the Ensembl consortium (http://www.ensembl.org/Mus_musculus/; genomic sequence: ENSMUSG–00000030834; predicted transcript: ENSMUST00000002850) also predicts a serine at position 1477 of the mouse Abcc6 protein. A BLAST search with the sequence of our Abcc6-3'UTR probe did not identify any other highly homologous sequences in addition to mouse Abcc6 cDNA, indicating that our probe would be highly specific for the detection of Abcc6 transcripts in an RPA.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 1. Detection of Abcc6 mRNA in normal mouse tissues by RNase protection. (A) Mouse Abcc6 mRNA sequence from position 4357 in exon 30 to the beginning of the poly(A) tail; an asparagine 1477S substitution predicted from our sequence analysis is indicated in the unshaded box; the sequence of the Abcc6-3'UTR probe is depicted in bold; the shaded box highlights a putative polyadenylation signal for the TC2 transcript; the sequences and positions of the nested poly(dT) primers (TC1b and TC2b) that were used for RT-PCR are indicated with arrows. (B) Phosphorimager scan of RPA: 0.4 ng undigested [33P]-GAPDH probe (2 x 107 cpm/µg, 403 bases; Lane 1) and 0.005 ng [33P]-Abcc6-3'UTR probe (2 x 109 cpm/µg, 677 bases; Lane 3). RNaseT1 digestion controls with 4 ng GAPDH and 0.05 ng Abcc6-3'UTR probes (Lanes 2 and 4); 40 µg of total RNA from different tissues was hybridized with 0.05 ng probe Abcc6-3'UTR and 4 ng control probe GAPDH and was digested with RNaseT1 (Lanes 5–23). Expected lengths of protected fragments were 316 bases for GAPDH and 586 bases for Abcc6-3'UTR. The additional band at 500 bases is a second Abcc6 mRNA with a shortened 3'UTR. (C) RPA on total RNA from liver with the Abcc6-3'UTR-TC2 probe: controls as in B with GAPDH and Abcc6-3'UTR-TC2 (603 bases) probes (Lanes 1–4). Hybridization of the Abcc6-3'UTR-TC2 probe with liver RNA resulted again in a shorter protected fragment of 512 bases (Lane 6).

By in vitro transcription, we prepared both a radiolabeled GAPDH control probe of 403 nucleotides (that should give rise to a 316 nucleotide protected fragment) and an Abcc6 antisense RNA probe, Abcc6-3'UTR, of 677 nucleotides in length, that if hybridized with Abcc6 mRNA and digested with RNase in a RPA should theoretically result in a 586-nucleotide protected radiolabeled fragment. However, when we hybridized total RNA from mouse liver with the Abcc6 antisense probe in an RPA, in addition to the expected band at 586 bases we observed another protected fragment of about 500 nucleotides (Fig 1B, Lane 5). This band occurred consistently with different RNA preparations from liver and from other tissues (Fig 1B, Lanes 5, 6, 8, 10, and 11) and persisted under varying RNase digestion conditions (not shown). Moreover, the ratio of both protected Abcc6-3'UTR fragments was different with RNAs from different tissues. In the eyes and brain, the 586-nucleotide fragment was more abundant than the smaller RNA fragment. In the kidney, intestine and colon, the smaller RNA was slightly more abundant and, in the liver, the shorter fragment was the prominent protected species. Because Abcc6-3'UTR contains part of the mouse 3' untranslated region of the Abcc6 mRNA, a shorter protected fragment may arise as a consequence of differential polyadenylation of mouse Abcc6 mRNA. Indeed, a BLAST search of mouse ESTs with the 3'UTR probe identified several matches. Three of these matches represented mouse ESTs found in RNA isolated from the cerebellum, liver, and diaphragm (GenBank accession numbers AW493424, BF322691, AI507076) that all had a defined poly(A) sequence 100 bases upstream of the published Abcc6 mRNA sequence.

On the basis of this information, we designed nested poly(dT) reverse primers mAbcc6-TC1b and mAbcc6-TC2b (Fig 1A) and used these primers, in combination with forward primer mAbcc6-ex30a, to amplify two species of differentially polyadenylated mRNAs by RT-PCR from liver RNA. We obtained a PCR product of 600 bp with primers mAbcc6-TC1b and mAbcc6-ex30a and a 512-bp product with primers mAbcc6-TC2b and mAbcc6-ex30a (data not shown). The sequences of the two PCR products identified the two differentially polyadenylated mRNA species, as suggested by the EST data and the published mRNA.

To finally verify if the shorter band that we obtained in the RPA with the original Abcc6-3'UTR probe corresponded to an Abcc6 mRNA with a shortened 3'UTR, we cloned the shorter PCR product into the same expression vector and in vitro synthesized radiolabeled probe Abcc6-3'UTR-TC2. RPA with this probe indeed yielded a 512-nucleotide protected fragment when hybridized with liver total RNA (Fig 1C, Lane 6; the 12 extra nucleotides are 12 adenosyl residues from the nested poly(dT) primer). Taken together, these results suggest that there are two differentially polyadenylated species of Abcc6 mRNA present in different mouse tissues and that the ratio of these two mRNAs varies in different tissues.

Tissue Distribution of Abcc6 mRNAs Detected by RNase Protection
Abcc6 mRNA levels in mouse are the highest in the liver (Fig 1B, Lane 5), the amount of mRNA in the kidney is considerably lower (Fig 1B, Lane 6). Intestine and colon show similarly low amounts of Abcc6 mRNA (Fig 1B, Lanes 10 and 11), and Abcc6 mRNA levels in the mouse brain and eye (Fig 1B, Lanes 7 and 8) are even lower. There are very faint bands corresponding to extremely low levels of Abcc6 mRNA in the stomach, heart, trachea, bladder, tongue, testis, and aorta (Fig 1B, Lanes 12, 13, 15, 16, 19, 20, and 23). Abcc6 mRNA in all the other tissues included was not detectable in this RPA with 40 µg total RNA per tissue.

ISH Reveals Abcc6 Expression in Various Cell Types and in Many Organs
To visualize which cells contain Abcc6 mRNA in tissues having high to low levels of transcripts as measured by RPA and to see if we could detect Abcc6 message in some additional cells in other tissues, we performed non-radioactive ISH (Komminoth 1992 Down). By in vitro transcription, we prepared digoxigenin (DIG)-labeled antisense and, as control, sense RNA probes from the same construct containing the 3'UTR of Abcc6 cDNA that we used for the RPA. We hybridized the probes to sections from formaldehyde-fixed, paraffin-embedded tissues obtained from C57BL/6 mice cut at 5 µm. DIG was then detected with alkaline phosphatase-coupled anti-DIG antibody followed by an NBT/BCIP color reaction. A dark blue to purple precipitate in the cytoplasm indicated the presence of Abcc6 transcripts (Fig 2 Fig 3 Fig 4, left columns of micrographs). In certain cells, i.e., endothelial cells (Fig 3C), not only the cytoplasm but the entire cell, including the nucleus, appeared to be stained, which was due to the thickness of the sections and the morphology of those cells. Sections hybridized with a control Abcc6 sense probe showed little or no staining in all tissues examined (Fig 2 Fig 3 Fig 4, right columns of micrographs).



View larger version (115K):
[in this window]
[in a new window]
 
Figure 2. ISH of different mouse tissues with DIG-labeled Abcc6 RNA probes. Abcc6 mRNA was found (A) in hepatic cells (arrowhead), in bile duct epithelial cells (black arrows), and in Kupffer cells (white arrows, higher-resolution inset) in the liver, (C) in the kidney, in the proximal convoluted tubule cells (black arrows) and, to a lesser extent, in the distal tubule cells (white arrows), (E) in most neurons (arrows) in the cerebrum, (G) in all neuron layers of the retina: in the ganglion cell layer (GC, black arrow), inner nuclear layer (IN, white arrow), outer nuclear layer (ON, arrowhead) and inner segments (IS, star). (B,D,F,H) with the sense probe, some low-level background staining was observed in all tissues.



View larger version (106K):
[in this window]
[in a new window]
 
Figure 3. ISH of different mouse tissues with DIG-labeled Abcc6 RNA probe, continued. Abcc6 mRNA was found (A) in the muscle cells (arrows) of the atrium of the heart, (C) in the endothelial cells (black arrows, inset) and smooth muscle cells (white arrows) of the elastic lamina of the aorta, (E) in leukocytes (arrow) in the peripheral blood, (G) in the keratinocytes of the epidermis (black arrows) and, to a lesser degree, in the fibroblasts (white arrow) and muscle cells (arrowhead) of the skin, (I) in the mucous epithelial cells (black arrow), chondrocytes (white arrow) and fibroblasts (arrowhead) in the trachea. (B,D,F,H,J) With sense probe some low-level background staining was observed.



View larger version (116K):
[in this window]
[in a new window]
 
Figure 4. ISH of different mouse tissues with DIG-labeled Abcc6 RNA probes, continued. Abcc6 mRNA was found (A) in the stratified squamous epithelium (black arrow) and muscle cells (white arrow) in the tongue, (C) in gland cells (arrows) in the stomach, in mucosa (black arrows) and gland cells (white arrows) in the small intestine (E) and colon (G); (B,D,F,H) With sense probe some low-level background staining was observed.

In the liver, staining was evident in all hepatic cells but was most intense in the epithelium of the bile ducts at the portal area (Fig 2A). Kupffer cells (Fig 2A, inset) and endothelial cells (not shown) were also stained. In the kidney, staining was most intense in cells of the proximal convoluted tubules and, to a lesser degree, in cells of the distal tubules (Fig 2C). The staining in the tubules of the medulla was generally weaker. Arterial endothelial cells were also stained (not shown). In the cerebrum, most neurons were heavily stained (Fig 2E). The ependymal epithelium lining the ventricles was also strongly stained (not shown). The strong staining we observed in neurons is somewhat discordant with the results obtained in the RNase protection assay that indicated the presence of only very low amounts of Abcc6 mRNA in the brain. A possible explanation might be that these very low amounts of message are locally concentrated on the rough ER around the nuclei of the neurons, whereas the more abundant Abcc6 mRNA in hepatocytes is distributed throughout the entire cytoplasm, thus resulting in an in situ staining of similar intensity but over a much larger surface. We could also detect Abcc6 message in neurons of the spinal cord (not shown). Neurons in all layers of the retina also contained Abcc6 mRNA (Fig 2G). The corneal epithelial cells and, to a lesser degree, fibroblasts and muscle cells in the sclera of the eye were also stained (not shown).

Muscle cells in the atria of the heart were heavily stained (Fig 3A), and those in the ventricles revealed moderate staining (not shown). Abcc6 mRNA was also detected in the endothelial cells of the endocardium and in the endothelial cells and smooth muscle cells of arteries, included in the heart tissue section (not shown). Staining of the endothelial cells and smooth muscle cells was especially evident in sections of the aorta (Fig 3C). Some staining could also be observed in the fibroblasts of the intima. We also observed strong staining of leukocytes in the blood (Fig 3E) and of lymphocytes in the thymus and lymph nodes (not shown). To confirm the presence of Abcc6 mRNA in leukocytes, we isolated total RNA from human buffy coat preparations and performed RT-PCR. As is evident from Fig 5, we were able to detect ABCC6 mRNA in leukocytes from normal individuals.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. RT-PCR detects ABCC6 mRNA in the human blood. RT-PCR on total RNA from leukocytes from two healthy individuals (a,b). Upper panel: a 527 bp PCR product corresponding to ABCC6 cDNA (position 3150 in exon 23 to position 3677 in exon 26; Lanes 1 and 3). Lower panel: a control RT-PCR confirmed the detection of ABCC1 mRNA; in control experiments reverse transcriptase (RT) was omitted from the cDNA preparation reaction (Lanes 2 and 4), or water replaced template DNA in the PCR reaction (Lane 5).

Keratinocytes in the epidermis of the skin and, to a lesser extent, fibroblasts and muscle cells in the dermis contained Abcc6 mRNA (Fig 3G). ISH revealed strong staining in the ciliated epithelium of the mucosa and in chondrocytes of the tracheal cartilage (Fig 3I). Bronchial epithelial cells were heavily stained (not shown). In the tongue, both filiform and fungiform papillal squamous epithelia were intensely stained (Fig 4A). In the stomach (Fig 4C), small intestine (Fig 4E), and colon (Fig 4G) gland cells, especially those in the basal layer of the mucosa, were strongly stained.

Although in some tissues Abcc6 mRNA levels were too low to be detected by RPA, ISH demonstrated the presence of Abcc6 mRNA in various epithelial cells known to be involved in secretion, endothelial cells, smooth and striated muscle cells, neurons in the cerebrum, spinal cord and retina, and leukocytes.

IHC Detection of Abcc6 Using the Rabbit Polyclonal Antibody HB-6
The rabbit polyclonal peptide antibody HB-6 has recently been shown to recognize the human ABCC6 protein by Western blotting analysis (Ilias et al. 2002 Down). The epitope(s) for this antibody is contained within a 25-amino-acid peptide corresponding to amino acids 230–254 of human ABCC6. The central 18 amino acids of this peptide are identical to the predicted mouse Abcc6 sequence. The peptide is located in the linker region of ABCC6, a diverse domain in the highly homologous ABCC protein subfamily. Western blotting analysis showed that this polyclonal antibody recognized a 160-kD protein in total tissue extracts and in subfractions of mouse liver containing plasma membranes (Fig 6, Lanes 1, 3, and 4). When the HB-6 peptide was added in a blocking assay, both the predominant band at 160 kD and an additional band at 100 kD, probably a degradation product of Abcc6, disappeared (Fig 6, Lanes 6, 8, and 9). To confirm our results on the tissue distribution of Abcc6, we used this antibody for IHC on formaldehyde-fixed, paraffin-embedded 2-µm sections. No significant staining was observed in control sections incubated with preimmune serum (not shown).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 6. The polyclonal rabbit antibody HB-6 recognizes Abcc6 in plasma membranes from mouse liver. A total tissue extract (TE; Lanes 1 and 6) and S1 supernatant (Lanes 2 and 7) from 250 µg liver tissue, a P1 pellet (Lanes 3 and 8), and isolated plasma membranes (PM; Lanes 4 and 9) from 0.5 mg liver tissue and purified Sf9 cells plasma membranes (PM; Lanes 5 and 10) overexpressing human ABCC6 (0.1 µg protein) were separated on SDS-PAGE and analyzed by Western blotting using the HB-6 antibody. The predominant protein recognized in total extract (Lane 1) and plasma membrane-containing fractions (Lanes 3 and 4) from mouse liver is approximately the same molecular weight as the human ABCC6 expressed in Sf9 cells (Lane 5). In a blocking assay, the HB-6 peptide was added at 50-fold molar access over the HB-6 antibody (Lanes 6–10).

Epithelial cells in the proximal convoluted tubules in the inner cortex of the kidney show basolateral membrane localization of Abcc6 (Fig 7A). We also observed a "dotted" staining within these epithelial cells, indicating a concentration of Abcc6 transporter molecules in some areas of the plasma membrane (Fig 7A). Epithelial cells in the distal tubules and other structures in the medulla are only moderately stained. Epithelial cells within the proximal tubules of the outer cortex and the strongly stained hepatocytes in the liver (not shown) showed predominantly cytoplasmic staining for Abcc6.



View larger version (140K):
[in this window]
[in a new window]
 
Figure 7. IHC detection of Abcc6 in mouse tissues. Formaldehyde-fixed paraffin sections were cut at 2 µm and reacted with the rabbit polyclonal antibody HB-6, followed by staining by the peroxidase–anti-peroxidase method and diaminobenzidine, counterstained with hematoxylin. (A) Basolateral membrane localization of Abcc6 in the proximal convoluted tubules (arrow) of the inner cortex of the kidney. (B) Retina: the nerve fiber layer (NF, black arrow) and ganglion cell layer (GC, white arrow), the inner plexiform layer (IP, black arrowhead), inner nuclear layer (IN, white arrowhead), outer plexiform layer (OP, white star), outer nuclear layer (ON, gray arrowhead), outer limiting membrane (OLM, gray arrow), and inner segments (IS, black star) are stained with the Abcc6 antibody. (C) Neurons in the cerebrum (arrows) are strongly stained. (D) Purkinje cells in the cerebellum: membrane localization of Abcc6 is indicated by black arrows in the nerve cell body, white arrows in primary dendrites, and arrowhead in dendritic branches. (E) In the intestine, the antibody staining of surface cells (black arrow) is stronger than the staining of the deeper cells (white arrow). (F) In the peripheral blood, leukocytes (white arrows) and the concave surfaces of erythrocytes (black arrows, inset) are stained. (G) Plasma membranes of some lymphocytes (arrows) in the lymph node are stained.

Consistent with our results on demonstrating Abcc6 mRNA in the retina, we observed antibody staining in all neuron layers of the retina (Fig 7B). In addition to other neurons in the cerebrum (Fig 7C), Purkinje cells in the cerebellum showed strong staining with the ABCC6 antibody (Fig 7D). Cells of the ependymal epithelium were also stained (not shown). In large ganglion cells in the spinal cord, we observed staining of the Nissl bodies (not shown).

In sections of the intestine, strong immunostaining for the Abcc6 protein was seen in the surface cells of the mucosa. This observation is in contrast to the predominant staining for mRNA that we observed in the basal cells of the mucosa (Fig 7E). A similar finding was noted in the mucosa of the colon (not shown). The surface of apical cells of the squamous epithelium of the tongue was also more strongly stained with HB-6 than the more basal cell layers (not shown), again in contrast to the stronger staining that we observed by the ISH in the basal cells.

In the peripheral blood, leukocytes and the concave surfaces of erythrocytes show immunostaining with the polyclonal ABCC6 antibody (Fig 7F). Plasma membranes of some but not all lymphocytes in the lymph nodes also show Abcc6 immunostaining (Fig 7G).


*   Discussion
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

In this report we have demonstrated the presence of Abcc6 mRNA and Abcc6 protein in various mouse tissues and cell types of normal mice. Tissue distribution of the human and rat orthologues of Abcc6 have previously been studied by RT-PCR (Bergen et al. 2000 Down), RNase protection assay (Kool et al. 1999 Down), and Northern blotting analysis (Madon et al. 2000 Down). By RPA in our study, Abcc6 mRNA levels were the highest in mouse liver, as has been shown for humans (Kool et al. 1999 Down) and rats (Madon et al. 2000 Down). Contrary to humans but consistent with the results obtained in rats, Abcc6 mRNA levels in murine kidney are considerably lower (Kool et al. 1999 Down; Madon et al. 2000 Down). We further detected Abcc6 mRNA in murine intestine, colon, brain, and eye. In agreement with our results, the presence of Abcc6/ABCC6 mRNA has been reported in rat intestine and colon (Madon et al. 2000 Down) and in human duodenum, jejunum, and colon (Kool et al. 1999 Down; Taipalensuu et al. 2001 Down). However, in these studies no Abcc6/ABCC6 mRNA has been detected in the brain of rats or humans (Kool et al. 1999 Down; Madon et al. 2000 Down). Moreover, in contrast, our results for RT-PCR on human retina did not detect any ABCC6 mRNA (Bergen et al. 2000 Down).

We identified two differentially polyadenylated species of Abcc6 mRNA. The ratio of these two species varied among different tissues. The 3'UTR of Abcc6 mRNA does not contain the consensus AATAAA polyadenylation signal that is found in 90% of mammalian mRNAs, but considerable variation in polyadenylation signals has previously been reported (Beaudoing et al. 2000 Down). The AATAAC hexamer (Fig 1A, shaded box), for example, could serve as a signal for the shorter, "TC2" transcript. However, there is no apparent second signal that would be responsible for adding a poly(A) tail to the "TC1" transcript approximately 100 bases downstream. Many genes have multiple polyadenylation sites (Gautheret et al. 1998 Down; O'Hare 1995 Down). Differential polyadenylation is considered a major post-transcriptional regulation mechanism in eukaryotes (Wahle and Keller 1996 Down). The use of multiple poly(A) sites can be tissue-specific and differentially regulated during development (O'Connor et al. 1988 Down; Jaramillo et al. 1991 Down; Lin et al. 1993 Down; Oyen et al. 1990 Down; Gautheret et al. 1998 Down). Moreover, the poly(A) tail plays an important role in message stability and translational efficiency (reviewed in Edwalds-Gilbert et al. 1997 Down). Taken together, our results suggest that not only the amount of Abcc6 mRNA present in a certain tissue but also the ratio of the two mRNA species will determine the amount of Abcc6 protein in these tissues.

This study reports the cellular localization of Abcc6 mRNA by ISH in a number of different cell types and confirms the tissue distribution by immunohistochemistry. In agreement with our data, rat Abcc6 and human ABCC6 have previously been shown to be localized to the basolateral plasma membrane in hepatocytes and kidney proximal tubules (Madon et al. 2000 Down; Scheffer et al. 2002 Down). Our ISH results demonstrated, in addition, Abcc6 mRNA in bile duct epithelial cells in mouse liver. We also report the presence of Abcc6 mRNA and protein in endothelial and arterial smooth muscle cells. Comparisons of the levels of the other MRP mRNAs in bovine brain microvessel endothelial cells revealed the presence of ABCC6 mRNA in endothelial cells (Zhang et al. 2000 Down). In another study, ABCC6 mRNA was detected in human blood vessel walls by RT-PCR (Bergen et al. 2000 Down). With the rabbit polyclonal peptide antibody HB-6 directed against human ABCC6, we were able to localize murine Abcc6 protein in all tissues that were shown to contain Abcc6 mRNA by ISH. Rat monoclonal antibodies against an MBP fusion protein containing amino acids 764–964 of human ABCC6 stained the basolateral membranes of hepatocytes and proximal tubules of the kidney but could not detect ABCC6 in frozen sections of other human tissues reported to contain ABCC6 mRNA (Scheffer et al. 2002 Down). This observation might be due to different fixation methods employed. The sensitivity of three monoclonal antibodies raised against an ABCC1 fusion protein, for example, appeared to be higher in formaldehyde-fixed, paraffin-embedded sections than in frozen sections (Flens et al. 1996 Down). We report a "dotted" labeling of plasma membranes with our polyclonal antibody. A similar dotted distribution has also been shown by confocal microscopy for the rat protein in the basolateral membranes of hepatocytes (Madon et al. 2000 Down).

In tissue sections of the small intestine and colon, we observed high levels of Abcc6 mRNA in the basal gland cells of the mucosal epithelium and less staining in the surface cells. However, by IHC Abcc6 protein was more abundant in the apical cells. This difference in mRNA vs protein abundance is probably a consequence of the rapid turnover of these epithelial cells by upward migration from localized regions of cell proliferation in the crypts of Lieberkuhn (and high mRNA levels) to the mucosal surface in the colon and villi in the small intestine containing terminally differentiated epithelial cells of low proliferative capacity (Leblond 1981 Down). Similarly, cells in the basal layers of the squamous epithelium of the tongue revealed stronger staining with ISH compared to the more apical cell layers. Again, the IHC analysis revealed stronger staining of the apical cell layer and the heavily keratinized cells at the tips of the papillae. A high abundance of Abcc6 mRNA in proliferative epithelial cells of the basal layer and the noted presence of the Abcc6 protein in surface cells is consistent with a half-life of the protein sufficiently long enough to permit the persistence of Abcc6 within quiescent surface cells.

Abcc1 (Mrp1) is found in the basolateral membrane of cells of Henle's loop and in the cortical collecting duct in the kidney of mice (Peng et al. 1999 Down). Human ABCC1 overexpressed in polarized kidney cells localizes to the basolateral membrane (Evers et al. 1996 Down) and is found in the plasma membrane of several multidrug-resistant tumor cell lines. Interestingly ABCC1 also showed granular cytoplasmic staining in keratinocytes and in apical cells of the intestine (Flens et al. 1996 Down). Flens and co-workers have therefore suggested a possible role of ABCC1 in the transport of compounds into intracellular compartments in normal cells. Similarly, some of the cytoplasmic staining we observed for Abcc6 may reflect true cytoplasmic localization. Frequent internalization as part of a regulatory mechanism has been demonstrated for the ABCA1 transporter in humans (Neufeld et al. 2001 Down) and for canalicular ABC transporters in rats (Kipp et al. 2001 Down; Kipp and Arias 2002 Down). A similar internalization mechanism for Abcc6 could also explain the cytoplasmic staining we have noted.

Human ABCC1 (MRP1) has previously been shown to exhibit almost ubiquitous tissue distribution (Kruh et al. 1995 Down; Flens et al. 1996 Down). In the intestine, colon, bronchial epithelium, keratinocytes in the skin, and erythrocytes, the presence of Abcc1/ABCC1 overlaps with that of Abcc6, whereas ABCC1 is only moderately expressed in hepatocytes and is absent from bile ducts in the liver, and no ABCC1 was detected in endothelial cells (Flens et al. 1996 Down; Pulaski et al. 1996 Down). ABCC1 transports glutathione conjugates such as leukotriene C4 (Jedlitschky et al. 1994 Down; Muller et al. 1994 Down; Leier et al. 1996 Down; Loe et al. 1996 Down; Pulaski et al. 1996 Down). As a basolaterally localized transporter, ABCC1 has been proposed to function in general detoxification of cells (Muller et al. 1996 Down). ABCC1 has also been suggested to play a role in protecting cells from oxidative stress by exporting 4HNE, a toxic lipid peroxidation product (Renes et al. 2000a Down). Abcc1 knockout mice are hypersensitive to drugs, display an increased tissue level of glutathione, and a decreased inflammatory response due to decreased secretion of LTC4 (Lorico et al. 1997 Down; Wijnholds et al. 1997 Down). Furthermore, LTC4 is a substrate for human ABCC6 in vitro (Ilias et al. 2002 Down). We have also demonstrated Abcc6 mRNA in leukocytes in the peripheral blood and lymphocytes in the lymph nodes. Residual export of LTC4 in bone marrow-derived mast cells from these Abcc1 KO mice therefore may be attributed to Abcc6 function. In some tissues, therefore, Abcc1 and Abcc6 might have overlapping and/or complementary function(s) in the detoxification of a number of different cell types.

ABCC1 in humans and rats is localized basolaterally in epithelial cells of the choroid plexus in the brain, conferring a basal-to-apical drug permeation barrier, and it has been suggested that ABCC1 may contribute to the blood–cerebrospinal fluid drug permeability barrier (Rao et al. 1999 Down). We have found Abcc6 mRNA in cells of the ependymal epithelium of the choroid plexus and in endothelial cells of arteries in the mouse brain. These observations, together with the previously noted expression of bovine ABCC6 in brain microvessel endothelial cells (Zhang et al. 2000 Down), suggest that Abcc6 might also contribute to the blood–brain and blood–CSF barriers and, together with Abcc1, protect the brain from circulating toxins.

An additional hypothetical function of Abcc6/ABCC6 may be in protecting not only the cytoplasm, as has been speculated for ABCC1, but also the extracellular space against oxidative stress. For example, the enzymatic activity of lysyl oxidases (amine oxidases that catalyze the crosslinking of collagen and elastin (reviewed in Csiszar 2001 Down), creates hydrogen peroxide in the ECM (Trackman and Kagan 1979 Down). If not protected by antioxidants, the accumulation of these free radicals could lead to elastic fiber abnormalities such as those seen in PXE. The transport by ABCC6 of free radical scavengers, such as reduced glutathione conjugates, could play a critical role in ensuring an appropriate concentration of antioxidants in the ECM, thus ensuring the correct assembly and deposition of ECM polymers such as elastic fibers.


*   Acknowledgments

Supported by NIH grants EY13019 and RR16453.

We are grateful to Drs Andras Varadi and Balazs Sarkadi for insightful comments regarding the possible functions of ABCC6.

Received for publication October 10, 2002; accepted February 10, 2003.


*   Literature Cited
*Top
*Summary
*Introduction
*Materials and Methods
*Results
*Discussion
*Literature Cited

Akabas MH (2000) Cystic fibrosis transmembrane conductance regulator. Structure and function of an epithelial chloride channel. J Biol Chem 275:3729-3732[Free Full Text]

Beaudoing E, Freier S, Wyatt JR, Claverie JM, Gautheret D (2000) Patterns of variant polyadenylation signal usage in human genes. Genome Res 10:1001-1010[Abstract/Free Full Text]

Bergen AA, Plomp AS, Schuurman EJ, Terry S, Breuning M, Dauwerse H, Swart J et al. (2000) Mutations in ABCC6 cause pseudoxanthoma elasticum. Nature Genet 25:228-231[Medline]

Borst P, Evers R, Kool M, Wijnholds J (1999) The multidrug resistance protein family. Biochim Biophys Acta 1461:347-357[Medline]

Csiszar K (2001) Lysyl oxidases: a novel multifunctional amine oxidase family. Prog Nucleic Acids Res Mol Biol 70:1-32[Medline]

Dean M, Hamon Y, Chimini G (2001) The human ATP-binding cassette (ABC) transporter superfamily. J Lipid Res 42:1007-1017[Abstract/Free Full Text]

Edwalds–Gilbert G, Veraldi KL, Milcarek C (1997) Alternative poly(A) site selection in complex transcription units: means to an end? Nucleic Acids Res 25:2547-2561[Abstract/Free Full Text]

Evers R, Zaman GJ, van Deemter L, Jansen H, Calafat J, Oomen LC, Oude Elferink RP et al. (1996) Basolateral localization and export activity of the human multidrug resistance-associated protein in polarized pig kidney cells. J Clin Invest 97:1211-1218[Medline]

Flens MJ, Zaman GJ, van der Valk P, Izquierdo MA, Schroeijers AB, Scheffer GL, van der Groep P et al. (1996) Tissue distribution of the multidrug resistance protein. Am J Pathol 148:1237-1247[Abstract]

Gautheret D, Poirot O, Lopez F, Audic S, Claverie JM (1998) Alternate polyadenylation in human mRNAs: a large-scale analysis by EST clustering. Genome Res 8:524-530[Abstract/Free Full Text]

Gottesman MM, Fojo T, Bates SE (2002) Multidrug resistance in cancer: role of ATP-dependent transporters. Nature Rev Cancer 2:48-58[Medline]

Hayashi K, Hayashi M, Jalkanen M, Firestone JH, Trelstad RL, Bernfield M (1987) Immunocytochemistry of cell surface heparan sulfate proteoglycan in mouse tissues. A light and electron microscopic study. J Histochem Cytochem 35:1079-1088[Abstract]

Higgins CF (1992) ABC transporters: from microorganisms to man. Annu Rev Cell Biol 8:67-113

Ilias A, Urban Z, Seidl TL, Le Saux O, Sinko E, Boyd CD, Sarkadi B et al. (2002) Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6). J Biol Chem 277:16860-16867[Abstract/Free Full Text]

Jaramillo M, Pelletier J, Edery I, Nielsen PJ, Sonenberg N (1991) Multiple mRNAs encode the murine translation initiation factor eIF-4E. J Biol Chem 266:10446-10451[Abstract/Free Full Text]

Jedlitschky G, Leier I, Buchholz U, Center M, Keppler D (1994) ATP-dependent transport of glutathione S-conjugates by the multidrug resistance-associated protein. Cancer Res 54:4833-4836[Abstract/Free Full Text]

Kipp H, Arias IM (2002) Trafficking of canalicular ABC transporters in hepatocytes. Annu Rev Physiol 64:595-608[Medline]

Kipp H, Pichetshote N, Arias IM (2001) Transporters on demand: intrahepatic pools of canalicular ATP binding cassette transporters in rat liver. J Biol Chem 276:7218-7224[Abstract/Free Full Text]

Ko YH, Pedersen PL (2001) Cystic fibrosis: a brief look at some highlights of a decade of research focused on elucidating and correcting the molecular basis of the disease. J Bioenerg Biomembr 33:513-521[Medline]

Komminoth P (1992) Digoxigenin as an alternative probe labeling for in situ hybridization. Diagn Mol Pathol 1:142-150[Medline]

Kool M, van der Linden M, de Haas M, Baas F, Borst P (1999) Expression of human MRP6, a homologue of the multidrug resistance protein gene MRP1, in tissues and cancer cells. Cancer Res 59:175-182[Abstract/Free Full Text]

Kruh GD, Gaughan KT, Godwin A, Chan A (1995) Expression pattern of MRP in human tissues and adult solid tumor cell lines. J Natl Cancer Inst 87:1256-1258[Free Full Text]

Kruh GD, Zeng H, Rea PA, Liu G, Chen ZS, Lee K, Belinsky MG (2001) MRP subfamily transporters and resistance to anticancer agents. J Bioenerg Biomembr 33:493-501[Medline]

Le Saux O, Beck K, Sachsinger C, Silvestri C, Treiber C, Goring HH, Johnson EW et al. (2001) A spectrum of ABCC6 mutations is responsible for pseudoxanthoma elasticum. Am J Hum Genet 69:749-764[Medline]

Le Saux O, Urban Z, Tschuch C, Csiszar K, Bacchelli B, Quaglino D, Pasquali–Ronchetti I et al. (2000) Mutations in a gene encoding an ABC transporter cause pseudoxanthoma elasticum. Nature Genet 25:223-227[Medline]

Leblond CP (1981) The life history of cells in renewing systems. Am J Anat 160:114-158[Medline]

Lebwohl M, Schwartz E, Lemlich G, Lovelace O, Shaikh–Bahai F, Fleischmajer R (1993) Abnormalities of connective tissue components in lesional and non-lesional tissue of patients with pseudoxanthoma elasticum. Arch Dermatol Res 285:121-126[Medline]

Leier I, Jedlitschky G, Buchler M, Buchholz U, Brom M, Keppler D (1996) Identification of the biosynthetic leukotriene C4 export pump in murine mastocytoma cells as a homolog of the multidrug-resistance protein. Eur J Biochem 242:201-205[Medline]

Lin B, Rommens JM, Graham RK, Kalchman M, MacDonald H, Nasir J, Delaney A et al. (1993) Differential 3' polyadenylation of the Huntington disease gene results in two mRNA species with variable tissue expression. Hum Mol Genet 2:1541-1545[Abstract/Free Full Text]

Loe DW, Almquist KC, Cole SP, Deeley RG (1996) ATP-dependent 17 beta-estradiol 17-(beta-D-glucuronide) transport by multidrug resistance protein (MRP). Inhibition by cholestatic steroids. J Biol Chem 271:9683-9689[Abstract/Free Full Text]

Lorico A, Rappa G, Finch RA, Yang D, Flavell RA, Sartorelli AC (1997) Disruption of the murine MRP (multidrug resistance protein) gene leads to increased sensitivity to etoposide (VP-16) and increased levels of glutathione. Cancer Res 57:5238-5242[Abstract/Free Full Text]

Madon J, Hagenbuch B, Landmann L, Meier PJ, Stieger B (2000) Transport function and hepatocellular localization of mrp6 in rat liver. Mol Pharmacol 57:634-641[Abstract/Free Full Text]

Mayer R, Kartenbeck J, Buchler M, Jedlitschky G, Leier I, Keppler D (1995) Expression of the MRP gene-encoded conjugate export pump in liver and its selective absence from the canalicular membrane in transport-deficient mutant hepatocytes. J Cell Biol 131:137-150[Abstract/Free Full Text]

Meier PJ, Sztul ES, Reuben A, Boyer JL (1984) Structural and functional polarity of canalicular and basolateral plasma membrane vesicles isolated in high yield from rat liver. J Cell Biol 98:991-1000[Abstract/Free Full Text]

Meloni I, Rubegni P, De Aloe G, Bruttini M, Pianigiani E, Cusano R, Seri M et al. (2001) Pseudoxanthoma elasticum: point mutations in the ABCC6 gene and a large deletion including also ABCC1 and MYH11. Hum Mutat 18:85[Medline]

Mendelsohn G, Bulkley BH, Hutchins GM (1978) Cardiovascular manifestations of pseudoxanthoma elasticum. Arch Pathol Lab Med 102:298-302[Medline]

Muller M, Meijer C, Zaman GJ, Borst P, Scheper RJ, Mulder NH, de Vries EG et al. (1994) Overexpression of the gene encoding the multidrug resistance-associated protein results in increased ATP-dependent glutathione S-conjugate transport. Proc Natl Acad Sci USA 91:13033-13037[Abstract/Free Full Text]

Muller M, Roelofsen H, Jansen PL (1996) Secretion of organic anions by hepatocytes: involvement of homologues of the multidrug resistance protein. Semin Liver Dis 16:211-220[Medline]

Neldner KH (1988) Pseudoxanthoma elasticum. Int J Dermatol 27:98-100[Medline]

Neufeld EB, Remaley AT, Demosky SJ, Stonik JA, Cooney AM, Comly M, Dwyer NK et al. (2001) Cellular localization and trafficking of the human ABCA1 transporter. J Biol Chem 276:27584-27590[Abstract/Free Full Text]

Nishida H, Endo M, Koyanagi H, Ichihara T, Takao A, Maruyama M (1990) Coronary artery bypass in a 15-year-old girl with pseudoxanthoma elasticum. Ann Thorac Surg 49:483-485[Abstract]

O'Connor MB, Binari R, Perkins LA, Bender W (1988) Alternative RNA products from the Ultrabithorax domain of the bithorax complex. EMBO J 7:435-445[Medline]

O'Hare K (1995) mRNA 3' ends in focus. Trends Genet 11:255-257[Medline]

Oyen O, Myklebust F, Scott JD, Cadd GG, McKnight GS, Hansson V, Jahnsen T (1990) Subunits of cyclic adenosine 3',5'-monophosphate-dependent protein kinase show differential and distinct expression patterns during germ cell differentiation: alternative polyadenylation in germ cells gives rise to unique smaller-sized mRNA species. Biol Reprod 43:46-54[Abstract]

Peng KC, Cluzeaud F, Bens M, Van Huyen JP, Wioland MA, Lacave R, Vandewalle A (1999) Tissue and cell distribution of the multidrug resistance-associated protein (MRP) in mouse intestine and kidney. J Histochem Cytochem 47:757-768[Abstract/Free Full Text]

Pulaski L, Jedlitschky G, Leier I, Buchholz U, Keppler D (1996) Identification of the multidrug-resistance protein (MRP) as the glutathione-S-conjugate export pump of erythrocytes. Eur J Biochem 241:644-648[Medline]

Rao VV, Dahlheimer JL, Bardgett ME, Snyder AZ, Finch RA, Sartorelli AC, Piwnica–Worms D (1999) Choroid plexus epithelial expression of MDR1 P glycoprotein and multidrug resistance-associated protein contribute to the blood-cerebrospinal-fluid drug-permeability barrier. Proc Natl Acad Sci USA 96:3900-3905[Abstract/Free Full Text]

Renes J, de Vries EE, Hooiveld GJ, Krikken I, Jansen PL, Muller M (2000a) Multidrug resistance protein MRP1 protects against the toxicity of the major lipid peroxidation product 4-hydroxynonenal. Biochem J 350(Pt 2):555-561

Renes J, de Vries EG, Jansen PL, Muller M (2000b) The (patho)physiological functions of the MRP family. Drug Resist Update 3:289-302[Medline]

Ringpfeil F, Lebwohl MG, Christiano AM, Uitto J (2000) Pseudoxanthoma elasticum: mutations in the MRP6 gene encoding a transmembrane ATP-binding cassette (ABC) transporter. Proc Natl Acad Sci USA 97:6001-6006[Abstract/Free Full Text]

Scheffer GL, Hu X, Pijnenborg AC, Wijnholds J, Bergen AA, Scheper RJ (2002) MRP6 (ABCC6) detection in normal human tissues and tumors. Lab Invest 82:515-518[Medline]

Schriml LM, Dean M (2000) Identification of 18 mouse ABC genes and characterization of the ABC superfamily in Mus musculus. Genomics 64:24-31[Medline]

Sternberger LA, Hardy PH, Jr, Cuculis JJ, Meyer HG (1970) The unlabeled antibody enzyme method of immunohistochemistry: preparation and properties of soluble antigen-antibody complex (horseradish peroxidase-antihorseradish peroxidase) and its use in identification of spirochetes. J Histochem Cytochem 18:315-333[Abstract]

Struk B, Cai L, Zach S, Ji W, Chung J, Lumsden A, Stumm M et al. (2000) Mutations of the gene encoding the transmembrane transporter protein ABC-C6 cause pseudoxanthoma elasticum. J Mol Med 78:282-286[Medline]

Taipalensuu J, Tornblom H, Lindberg G, Einarsson C, Sjoqvist F, Melhus H, Garberg P et al. (2001) Correlation of gene expression of ten drug efflux proteins of the ATP-binding cassette transporter family in normal human jejunum and in human intestinal epithelial Caco-2 cell monolayers. J Pharmacol Exp Ther 299:164-170[Abstract/Free Full Text]

Thomas PM, Cote GJ, Wohllk N, Haddad B, Mathew PM, Rabl W, Aguilar–Bryan L et al. (1995) Mutations in the sulfonylurea receptor gene in familial persistent hyperinsulinemic hypoglycemia of infancy. Science 268:426-429[Abstract/Free Full Text]

Trackman PC, Kagan HM (1979) Nonpeptidyl amine inhibitors are substrates of lysyl oxidase. J Biol Chem 254:7831-7836[Free Full Text]

Uitto J, Boyd CD, Lebwohl MG, Moshell AN, Rosenbloom J, Terry S (1998) International Centennial Meeting on Pseudoxanthoma Elasticum: progress in PXE research. J Invest Dermatol 110:840-842[Medline]

Uitto J, Pulkkinen L, Ringpfeil F (2001) Molecular genetics of pseudoxanthoma elasticum: a metabolic disorder at the environment-genome interface? Trends Mol Med 7:13-17[Medline]

Uitto J, Shamban A (1987) Heritable skin diseases with molecular defects in collagen or elastin. Dermatol Clin 5:63-84[Medline]

Wada M, Toh S, Taniguchi K, Nakamura T, Uchiumi T, Kohno K, Yoshida I et al. (1998) Mutations in the canilicular multispecific organic anion transporter (cMOAT) gene, a novel ABC transporter, in patients with hyperbilirubinemia II/Dubin-Johnson syndrome. Hum Mol Genet 7:203-207[Abstract/Free Full Text]

Wahle E, Keller W (1996) The biochemistry of polyadenylation. Trends Biochem Sci 21:247-250[Medline]

Weenink AC, Dijkman G, de Meijer PH (1996) Pseudoxanthoma elasticum and its complications: two case reports. Neth J Med 49:24-29[Medline]

Wijnholds J, Evers R, van Leusden MR, Mol CA, Zaman GJ, Mayer U, Beijnen JH et al. (1997) Increased sensitivity to anticancer drugs and decreased inflammatory response in mice lacking the multidrug resistance-associated protein. Nature Med 3:1275-1279[Medline]

Zhang Y, Han H, Elmquist WF, Miller DW (2000) Expression of various multidrug resistance-associated protein (MRP) homologues in brain microvessel endothelial cells. Brain Res 876:148-153[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Pharmacol. Rev.Home page
C. D. Klaassen and L. M. Aleksunes
Xenobiotic, Bile Acid, and Cholesterol Transporters: Function and Regulation
Pharmacol. Rev., March 1, 2010; 62(1): 1 - 96.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Aherrahrou, L. C. Doehring, E.-M. Ehlers, H. Liptau, R. Depping, P. Linsel-Nitschke, P. M. Kaczmarek, J. Erdmann, and H. Schunkert
An Alternative Splice Variant in Abcc6, the Gene Causing Dystrophic Calcification, Leads to Protein Deficiency in C3H/He Mice
J. Biol. Chem., March 21, 2008; 283(12): 7608 - 7615.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
R. Zarbock, D. Hendig, C. Szliska, K. Kleesiek, and C. Gotting
Pseudoxanthoma Elasticum: Genetic Variations in Antioxidant Genes Are Risk Factors for Early Disease Onset
Clin. Chem., October 1, 2007; 53(10): 1734 - 1740.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
I. Audo, O. M. Vanakker, A. Smith, B. P. Leroy, A. G. Robson, S. A. Jenkins, P. J. Coucke, A. C. Bird, A. De Paepe, G. E. Holder, et al.
Pseudoxanthoma Elasticum with Generalized Retinal Dysfunction, a Common Finding?
Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 4250 - 4256.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Meng, I. Vera, N. Che, X. Wang, S. S. Wang, L. Ingram-Drake, E. E. Schadt, T. A. Drake, and A. J. Lusis
Identification of Abcc6 as the major causal gene for dystrophic cardiac calcification in mice through integrative genomics
PNAS, March 13, 2007; 104(11): 4530 - 4535.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. G. Deeley, C. Westlake, and S. P. C. Cole
Transmembrane Transport of Endo- and Xenobiotics by Mammalian ATP-Binding Cassette Multidrug Resistance Proteins.
Physiol Rev, July 1, 2006; 86(3): 849 - 899.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
S. Dallas, D. S. Miller, and R. Bendayan
Multidrug resistance-associated proteins: expression and function in the central nervous system.
Pharmacol. Rev., June 1, 2006; 58(2): 140 - 161.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
D. Hendig, V. Schulz, M. Arndt, C. Szliska, K. Kleesiek, and C. Gotting
Role of Serum Fetuin-A, a Major Inhibitor of Systemic Calcification, in Pseudoxanthoma Elasticum
Clin. Chem., February 1, 2006; 52(2): 227 - 234.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
N Chassaing, L Martin, P Calvas, M Le Bert, and A Hovnanian
Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations
J. Med. Genet., December 1, 2005; 42(12): 881 - 892.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. F. Klement, Y. Matsuzaki, Q.-J. Jiang, J. Terlizzi, H. Y. Choi, N. Fujimoto, K. Li, L. Pulkkinen, D. E. Birk, J. P. Sundberg, et al.
Targeted Ablation of the Abcc6 Gene Results in Ectopic Mineralization of Connective Tissues
Mol. Cell. Biol., September 15, 2005; 25(18): 8299 - 8310.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. G.M.F. Gorgels, X. Hu, G. L. Scheffer, A. C. van der Wal, J. Toonstra, P. T.V.M. de Jong, T. H. van Kuppevelt, C. N. Levelt, A. de Wolf, W. J.P. Loves, et al.
Disruption of Abcc6 in the mouse: novel insight in the pathogenesis of pseudoxanthoma elasticum
Hum. Mol. Genet., July 1, 2005; 14(13): 1763 - 1773.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Aranyi, M. Ratajewski, V. Bardoczy, L. Pulaski, A. Bors, A. Tordai, and A. Varadi
Identification of a DNA Methylation-dependent Activator Sequence in the Pseudoxanthoma Elasticum Gene, ABCC6
J. Biol. Chem., May 13, 2005; 280(19): 18643 - 18650.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Bunda, N. Kaviani, and A. Hinek
Fluctuations of Intracellular Iron Modulate Elastin Production
J. Biol. Chem., January 21, 2005; 280(3): 2341 - 2351.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Beck, K.
Right arrow Articles by Boyd, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Beck, K.
Right arrow Articles by Boyd, C. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact