doi:10.1369/jhc.6A7072.2006
Volume 55 (2): 151-166, 2007 Copyright ©The Histochemical Society, Inc. Anterior Pituitary Leptin Expression Changes in Different Reproductive States: In Vitro Stimulation by Gonadotropin-releasing Hormone
Department of Neurobiology and Developmental Sciences, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas (NA,BWJ,CC,GVC); Division of Endocrinology, Department of Internal Medicine, Roy J. and Lucille A. Carver College of Medicine, The University of Iowa, Iowa City, Iowa (MI); Department of Neurological Surgery, University of California Irvine, Orange, California (Y-HZ); and Department of Anatomy, Kyorin University School of Medicine, Tokyo, Japan (AK) Correspondence to: Noor Akhter, PhD, Department of Neurobiology and Developmental Sciences, College of Medicine, University of Arkansas for Medical Sciences, 4301 W. Markham St., Slot 510, Little Rock, AR 72205. E-mail: akhternoor{at}uams.edu
This study was designed to learn more about the changes in expression of rat anterior pituitary (AP) leptin during the estrous cycle. QRT-PCR assays of cycling rat AP leptin mRNA showed 2-fold increases from metestrus to diestrus followed by an 86% decrease on the morning of proestrus. Percentages of leptin cells increased in proestrus and pregnancy to 5560% of AP cells. Dual labeling for leptin proteins and growth hormone (GH) or gonadotropins showed that the rise in leptin protein-bearing cells from diestrus to proestrus was mainly in GH cells. Only 1020% of leptin cells in male or cycling female rats coexpress gonadotropins. In contrast, 5073% of leptin cells from pregnant or lactating females coexpress gonadotropins and only 19% coexpress GH, indicating plasticity in the distribution of leptin. Leptin cells expressed GnRH receptors, and estrogen and GnRH together increased the coexpression of leptin mRNA and gonadotropins. GnRH increased cellular leptin proteins three to four times and mRNA 9.8 times in proestrous rats and stimulated leptin secretion in cultures from diestrous, proestrous, and pregnant rats. These regulatory influences, and the high expression of AP leptin during proestrus and pregnancy, suggest a supportive role for leptin during key events involved with reproduction. (J Histochem Cytochem 55:151166, 2007)
Key Words: leptin gonadotropes somatotropes gonadotropin-releasing hormone estrous cycle pregnancy lactation QRT-PCR in situ hybridization immunolabeling
LEPTIN PRODUCTION by white fat cells signals the levels of fat depots in the body to the brain and hence regulates food intake (Zhang et al. 1994
However, leptin has also recently been recognized as a multifunctional paracrine regulator in a number of organs including the anterior pituitary (AP) (Jin et al. 1999
One important candidate regulator proposed for testing was gonadotropin-releasing hormone (GnRH). This neuropeptide is produced by neurons scattered in the preoptic and anterior regions of the hypothalamus, stretching back to the arcuate nucleus (Conn et al. 1987 In the present group of studies, we continued our analysis of changes in the expression of leptin with different reproductive states, adding tests of leptin expression by pituitaries from rats during the afternoon of proestrus as well as tests of pituitaries from pregnant or lactating rats. We tested the efficacy of GnRH in the regulation of AP leptin expression, comparing exposures of 1 hr and 3 hr in cells from rats in proestrus. The findings presented in this report show that the expression of leptin proteins and mRNA in normal male and cycling female rats predominates in somatotropes. However, coexpression of leptin mRNA and proteins can also be found in subpopulations of gonadotropes, which predominate in pregnant or lactating females. The study will also present in vitro data demonstrating that leptin-bearing cells express GnRH receptors, and that GnRH stimulates the expression of leptin mRNA, proteins, and secretion.
Animals Male and female Sprague Dawley rats weighing 200250 g were obtained from Harlan Sprague Dawley (Indianapolis, IN) and were acclimated and housed three to four per cage with a 12 hr on, 12 hr off light/dark cycle for 710 days before use. Vaginal smears were used to determine the stage of the cycle, as previously described (McDuffie et al. 2004 To obtain pregnant females, proestrous females were placed individually in the same cage with a male for 1 night. The smear was checked for sperm the next morning. We then separated the female, if pregnant, and sacrificed her on the fourth day at 10:00 AM. We checked the uterus for embryos at the time of sacrifice and all six females were found to be pregnant. For the lactating females, we sacrificed the mothers (six rats) on the third day of lactation at 10:00 AM.
Pituitaries from all animals were taken either at 10:00 AM (all stages of the cycle) or 2:00 PM (diestrus or proestrus) from animals that had completed two successful estrous cycles. Rats were sacrificed by decapitation under anesthesia as previously described (McDuffie et al. 2004
Stimulation of Dispersed Pituitary Cells Tests of expression of leptin and other pituitary hormones show that there are no changes in percentages of labeled cells when the culture is extended for as long as 48 hr. Percentages of LH and GH cells are similar to those freshly dispersed cultures as they are in sections; however, labeling is more intense in the whole cells and it is easier to detect labeled small cells. The enzymatic dispersion process and the subsequent 12 hr of culture were not deleterious to the detection of product. In cases where we use a longer incubation in secretagogue, estrogen, or vehicle, percentages of leptin-bearing cells remain comparable to those in freshly dispersed cultures.
After 12 hr of plating, freshly dispersed pituitary cells from proestrous female or male rats were treated for 1 hr or 3 hr with vehicle or 10 pM1000 pM GnRH. The vehicle was defined as serum-free media (McDuffie et al. 2004
Immunocytochemistry
Affinity Cytochemistry for GnRH Receptors
Once GnRH binding was detected on cells with leptin proteins, further tests of diestrous rats were conducted in which cells were treated overnight with vehicle or 100 pM estradiol (Childs et al. 2005
In Situ Hybridization
Analysis of Labeling and Statistics Cytochemical labeling was analyzed by either cell counts or by Bioquant Nova Image Analysis equipment (Bioquant Image Analysis Corp.; Nashville, TN) with an algorithm that integrated label density and area and changes in both numbers of labeled cells as well as the amount of label per cell. This protocol is described in a recent report (Iruthayanathan et al. 2005
EIA
RNA Extraction, cDNA Synthesis, and QRT-PCR iScript cDNA synthesis (Bio-Rad Laboratories; Hercules, CA) was used to reverse transcribe total RNA in an MJ PTC 150 Minicycler (MJ Research; Cambridge, MA) in a 20-µl reaction mixture containing 4 µl 5x iScript, 1 µl reverse transcriptase, and 15 µl RNA per manufacturer's protocol (25C at 5 min, 50C at 30 min, and 85C at 5 min). Tests of serial dilutions for the cDNA samples showed reproducible assays of leptin mRNA with dilutions spanning 1:101:100. Aliquots were frozen at 80C and diluted 1:10 and 1:100 for the QRT-PCR assay for leptin mRNA.
Standards for each gene for QRT-PCR were prepared according to the method of Zhou et al. (2003)
QRT-PCR assays were run in a Roche Light Cycler 1.2 (Roche Applied Sciences; Indianapolis, IN). QRT-PCR was carried out as in our previous study with the FAST-START DNA Master SYBR Green I enzyme mix (Roche Applied Sciences). The housekeeping gene used to normalize the readings was hypoxanthine guanine phosphoribosyltransferase (HPRT) as described in our previous publication (Iruthayanathan et al. 2005 During the course of running the leptin assays, we experienced some difficulties with the SYBR green detection system, as it often resulted in a product that included primer dimers, rendering the final product levels uninterpretable. Therefore, we switched to the Roche Applied Sciences "Universal Probe System", which was run according to the kit instructions. The Universal probe designed for the detection of leptin was #13 (Cat. #04685121001). Universal Probe #13 reacts with nucleotides 220227, aggcagag in the leptin cDNA template. The forward primer designed by Roche for the amplification of leptin was ccaggatcaatgacatttcaca (nucleotides 179200) and the reverse primer was aatgaagtccaaaccggtga (nucleotides 230249) in NM_013076.1. The amplicon is a 71-bp sequence that includes one 1564-bp intron-spanning region at bp 203204. We used the same standards that were produced for the SYBR Green protocol. The Lightcycler Taqman Master Kit (Roche Applied Sciences) was prepared as described in the instructions (Cat. #04535286001), and then a master mix was prepared that included the following components (multiplied by a factor that varied with the numbers of tubes). For each tube there was 10.4 µl of nuclease-free water, 0.2 µl of Universal probe #13 (10 µM stock), 0.2 µl each of forward and reverse primers (20 µM used to make a final concentration of 200 nM), and 4 µl of the prepared TaqMan master. The master mix was added (15 µl) to each of the glass tubes, and then 5 µl of standard (101105), 1:10 diluted sample cDNAs or Tris was added to individual tubes. All samples were run in duplicate. The Tris or water control served as a negative control. After the tubes were set up, they were centrifuged for 10 sec and then placed in the Light Cycler that was programmed as follows: preincubation95C, 10 min, 45 cycles: denaturation95C, 10 sec; annealing60C, 30 sec; and extension72C, 1 sec. After 4555 cycles they were cooled at 45C for 1 min. This protocol allowed us to successfully detect product in all samples. It avoids the formation of primer dimers, thus having the advantage of being more specific. With these primers, only leptin amplicons are detected by Universal probe #13.
Changes in Leptin Expression With the Reproductive State We previously reported changes in leptin proteins (McDuffie et al. 2004
There is a gradual rise in percentages of AP cells with leptin proteins from a low of 21.0 ± 4.0% on the morning of estrus to a peak of 55.0 ± 3.0% of AP cells on the afternoon of proestrus. Figures 2C2E illustrate fields labeled for leptin proteins, comparing labeling on the morning and evening of proestrus and showing reduced labeling on the morning of estrus. Peak expression of leptin during proestrus is higher than that in all other groups (p<0.001) including male rats, which had 39.6 ± 1.0% of AP cells with leptin proteins. Leptin mRNA is expressed in 3237% of pituitary cells in male or in estrous, metestrous, or diestrous female rats (Figure 2). Thus, early in the cycle (estrus and metestrus), there are more cells with leptin mRNA than leptin proteins. There are no significant differences among these groups. However, there is a significant decline (p<0.002) in the percentages of cells with leptin mRNA to 20.0 ± 3.0% on the morning of proestrus. This reduction on the morning of proestrus was confirmed by the QRT-PCR assays (Figure 2B), which showed a significant 86% decline from diestrous afternoon to proestrous morning (p<0.007). QRT-PCR assays show that leptin mRNA is maintained at relatively low levels through estrus. Then, levels rise during metestrus and diestrus. The 2-fold rise in diestrus morning and afternoon is to values higher than all other groups (p<0.015). There are no differences between the two diestrous values. Increase in mRNA from metestrus to diestrus detected by the QRT-PCR assays was not detected by a change in percentages of leptin-bearing cells. However, densitometric analysis showed that the total area of label for leptin mRNA increased from 844.0 ± 114.0 µm2 to 1246.0 ± 15.0 µm2 (p<0.01) during this period. To learn if other reproductive states were associated with changes in pituitary leptin, cell populations from pregnant or lactating rats were studied. Figure 3 shows that populations from pregnant rats contained relatively the highest percentages of AP cells with leptin proteins (60.0 ± 2.0%) or mRNA (44.0 ± 2.0%), when compared with all other groups. Percentages of AP cells with leptin proteins are higher than those from males and all cycling groups except females taken on the afternoon of proestrus. The values for mRNA-bearing cells are higher than those from all other groups (p<0.001).
AP populations from females taken on the third day of lactation had mid-range levels of leptin proteins when compared with other physiological states. There were 32.0 ± 3.0% cells with leptin proteins and 40.0 ± 2.0% cells with leptin mRNA (Figure 3). Percentages of AP cells with leptin proteins in lactating rats are higher than those from estrous rats (p<0.02) and lower than those from proestrous (p<0.047) or pregnant rats (p<0.001). Percentages of AP cells with leptin mRNA are higher than all groups except pregnant rats. Photographs of fields from these rats are also illustrated in Figure 3.
Cell Types That Coexpress Leptin Proteins When coexpression of leptin proteins and GH proteins was tested, there was a significant increase (p<0.001) in the percentages of dual-labeled AP cells from 25.0 ± 3.0% on the morning of diestrus to 37.0 ± 4.0% of the population on the morning of proestrus (Figure 4 ). This increment (12 percentage points) matches that seen when the total percentages of AP cells with leptin were calculated (Figure 2). The overall percentage of AP cells with GH proteins did not change significantly. It was 36.0 ± 6.0% on the morning of diestrus and 41.0 ± 4.0% on the morning of proestrus.
In contrast, the percentage of AP cells that coexpressed leptin and gonadotropins did not change from diestrus to proestrus. Diestrous populations had 6.5 ± 1.0% or 7.0 ± 1.0% cells with leptin and LH or FSH, respectively, and proestrous populations had 8.0 ± 2.0% AP cells with leptin and LH or FSH (Figure 4). Previous studies have shown that bihormonal (cells with both LH and FSH) gonadotropes predominate in the population of diestrous and proestrous rats, representing >70% of the gonadotrope population (Childs et al. 1987 Cultures from male rats exhibited a profile similar to that of diestrous rats with 26.0 ± 2.0% of AP cells coexpressing leptin and GH. Only 4.0% of AP cells coexpressed leptin and LH or FSH in the male, values which were also not different from diestrous rats. Those for AP cells coexpressing leptin and LH were significantly lower than percentages seen on the morning of proestrus (p=0.045). Significant plasticity in expression was seen in populations from pregnant or lactating rats (Figure 4A) as leptin-bearing cells shifted from being predominantly somatotropes to predominantly gonadotropes. There were no significant changes in the percentages of cells with GH proteins in pregnant or lactating rats. There was a significant reduction (p<0.001) in the percentages of AP cells that coexpressed GH and leptin proteins to 12.0 ± 2.0% in the populations from pregnant females and 6.6 ± 1.0% in those from lactating females. In pregnant rat cells, there was a significant rise in percentage of AP cells that coexpressed LH or FSH and leptin to 42.0 ± 1.0% or 36.0 ± 4.0%, respectively. Cells from lactating females also had significantly more AP cells with LH and leptin (18.7 ± 0.4%) or FSH and leptin (17.0 ± 1.0%) than all other groups except pregnant rats. The analysis also focused on the proportion of leptin-bearing cells that expressed each of the pituitary hormones tested. These values were also used to predict if other cells contributed to leptin-bearing cells and to validate the data in Figure 4A. Validation was done by manually multiplying the percentages of leptin cells that contained each of the hormones by the overall percentages of AP cells that contained leptin, as reported in Figure 2 and Figure 3. These calculated percentages were within 0.51.0 percentage points of those derived from the cell counts in Figure 4A. GH stores are found in 6771% of leptin protein-bearing cells in males or in diestrous or proestrous females, values that are not significantly different from one another (Figure 4B). In contrast, only 1920% of leptin cells coexpress GH proteins in pregnant or lactating animals, which is significantly lower than values from the other groups (p<0.001). LH is found in 1417% and FSH is found in 1719% of leptin cells in diestrous and proestrous rat populations, values that are not different from one another. As stated above, it is likely that leptin may be expressed in gonadotropes, at least half of which are bihormonal (store both LH and FSH). In populations from pregnant rats, most leptin-bearing cells express LH (73.0 ± 2.0% of leptin cells) and/or FSH (62.0 ± 6.0% of leptin cells). These data show clear overlap in the percentages of leptin-bearing cells with gonadotropins, supporting the hypothesis that leptin is expressed in part by bihormonal gonadotropes. In male rats, only 10% of leptin cells coexpress LHß or FSHß proteins. LH values are significantly lower (p<0.006) than all female groups, except those from proestrus morning. The percentage of leptin cells with FSH in the male is lower than all female groups (Student's t-test). Figure 4 also depicts the dual labeling for leptin proteins and GH (Figures 4C and 4D) or LHß proteins (Figures 4E and 4F) in proestrous (Figures 4C and 4E) or pregnant (Figures 4D and 4F) rats. The fields dual labeled for leptin and GH show the contrast between the numerous dual-labeled cells in the proestrous female rat (Figure 4C) with only one in the field from the pregnant rat (Figure 4D). Similarly, few LH cells coexpress leptin in the field from the proestrous rat (Figure 4E), and there are numerous dual-labeled LHleptin cells in the field from the pregnant rat (Figure 4F).
Cell Types That Coexpress Leptin mRNA
The loss in cells coexpressing GH and leptin mRNA was again evident in pregnant and lactating females; values are significantly lower than values in diestrous animals (p<0.001) (Figure 5A). In contrast, more AP cells coexpressed leptin mRNA and LHß proteins (1617%), values which were significantly higher than those from diestrous rats (p<0.001). In cells from male rats, 26.0 ± 1.0% of AP cells express leptin mRNA and GH proteins, which is comparable to the levels seen in the dual-immunolabeled fields and greater than values in the diestrous female or those from pregnant or lactating animals (p<0.001) (Figure 5A). When LH gonadotropes were analyzed, the percentages of AP cells with leptin mRNA and LHß in the male were comparable to those seen after dual immunolabeling. Percentages of leptin mRNA-bearing cells that contain GH are higher in the male than all of the female groups (73.0 ± 2.0%; p<0.001) (Figure 5B). Percentages of leptin mRNA-bearing cells that contain LHß are only 10.0 ± 2.0% in cells from male rats and 20.0 ± 2.0% in those from diestrous females, which is significantly higher than values in the male (p<0.01; Student's t-test). As in the case of dual immunolabeling, pregnant and lactating rats had more leptin-bearing cells with LHß proteins (36.0 ± 1.0 or 44.0 ± 9.0% of leptin cells in pregnant or lactating groups, respectively). These values were not different from one another but were significantly higher than those from all other groups. Figures 5C and 5D also illustrate the dual labeling for leptin mRNA and GH or LHß in pregnant rats, showing the low expression of leptin mRNA in GH cells (Figure 5C) and the high expression in cells with LHß antigens (Figure 5D).
GnRH and Estrogen Effects on Leptin Expression
Estrogen is a well-established modulator of GnRH receptors, and our previous studies have shown that 100 pM increases the percentage of GnRH target cells when given overnight to diestrous rats (Lloyd and Childs 1988 The next study was designed to learn if estrogen and GnRH could increase leptin expression by gonadotropes. Three groups of cells pooled from three diestrous rats/group were treated with and without 100 pM estradiol overnight and then given vehicle or 1 nM GnRH for 1 hr the next morning. They were then fixed and labeled for leptin mRNA followed by immunolabeling for LHß or FSHß. Neither estrogen nor GnRH alone stimulated more gonadotropes to express leptin mRNA (data not shown). However, Figure 6D shows that when added, estrogen and GnRH stimulated a significant increase in AP cells that coexpress LHß and leptin mRNA from 7.0 ± 2.0% to 11.0 ± 3.0% (p<0.03) of AP cells. Similarly, estrogen and GnRH together stimulated an even greater increase in the percentages of cells with leptin mRNA and FSHß from 8.0 ± 3.0% to 15.0 ± 6.0% (p<0.02). To test if the overnight incubation in estrogen may have caused losses in expression of leptin mRNA, these data were compared with those from freshly dispersed cultures (7.0 ± 1.0% of AP cells from diestrous rats express leptin mRNA and LHß, as shown in Figure 5A). Similarly, 7.25 ± 2.8% of AP cells coexpress leptin mRNA and FSHß in these same cultures. Both sets of findings point to no losses in leptin mRNA during the overnight incubation in estrogen.
GnRH Stimulation of Cellular and Secreted Leptin Figure 7A illustrates the study of freshly dispersed cells from rats taken on the morning of proestrus. There is a significant increase in the average integrated optical density (IOD) of labeling after 1 hr in 100 pM GnRH (p<0.001), which plateaus at 500 pM. However, there is a significant decrease in IOD of labeling for leptin proteins after 1 nM GnRH (p<0.03) when compared with that following 500 pM. The value for 1 nM GnRH is still higher than the IOD for the vehicle-treated group (p=0.009). Similar studies were done of cells treated for 3 hr with GnRH, and there were no differences in expression of leptin proteins or mRNA.
Figure 7B shows a similar response to GnRH when IOD of label for mRNA was detected. Note that the average IOD in the vehicle control is 5-fold lower than that for the proteins (Figure 7A). This reflects the lower expression of mRNA on the morning of proestrus seen in Figure 2. The IOD for leptin mRNA label is significantly increased in all three concentrations of GnRH; the increase with 100 pM is significant by Student's t-test (p<0.001), and there is a further increase to reach a peak with 500 pM (p<0.008). The IOD following 1 nM is not different from that with 500 pM. GnRH also stimulated secretion of leptin from cultures of pituitary cells taken from diestrous, proestrous, or pregnant females. Figure 8 compares basal and GnRH-stimulated secretion in these groups. Basal secretion is significantly higher when one compares media from pregnant rat AP cells with that from diestrous rats (p=0.012). GnRH-stimulated secretion is increased over basal in each of the groups (diestrous p=0.016; proestrus p<0.015, and pregnant p<0.01). Cells from pregnant rats show the highest responses to GnRH when compared with all others.
This study was designed to learn more about changes in pituitary leptin with different reproductive states. Our earlier study had shown leptin mRNA and protein expression in somatotropes and changes in protein expression with the estrous cycle (McDuffie et al. 2004
As in the previous study (McDuffie et al. 2004
Leptin Regulation During Estrous Cycle In contrast, pituitary leptin appears to be differentially regulated in cycling females so that percentages of AP cells that express leptin proteins reach a peak just before the LH surge on the afternoon of proestrus. Then, the leptin-bearing cells lose stores of leptin by the morning of estrus and become invisible to immunolabeling. This suggests that the stores may have been secreted, although we cannot rule out degradation as a cause of the reduction. Pituitary leptin secretion could thus contribute to the higher serum levels seen after ovulation. Leptin-bearing cells could still be detected by their content of mRNA during estrus. Thus, the cells themselves did not disappear.
The rise in leptin protein-bearing cells seen just before the LH surge indicates that it may play an important role with respect to ovulation. A more specific paracrine role is suggested by the fact that leptin is known to be a secretagogue for LH, both in vivo and in vitro (Yu et al. 1997a
Leptin mRNA expression was in 3237% of the cells early in the cycle (from estrus to diestrus). Quantification by QRT-PCR showed a dramatic rise in transcripts on diestrus morning and afternoon, 12 hr before peak expression of leptin proteins is detected. This rise during diestrus thus supports the increased proteins needed for proestrous activity. As we studied the changes in percentages of cells with leptin mRNA, we noted a significant decline on the morning of proestrus, which was confirmed by the QRT-PCR assays. This rapid decline is intriguing and suggests that leptin transcripts are tightly regulated during the cycle, perhaps by rapid degradation. This pattern of expression indicates that the timing of this periovulatory expression of pituitary leptin may be important. Leptin is an anorexigenic hormone, which has potent inhibitory effects on neurons that stimulate appetite (Zhang et al. 1994
Changes in leptin expression during the cycle and after pregnancy suggested that reproductive hormones like estrogen or GnRH might be involved in its regulation. Our previous studies (McDuffie et al. 2004
In the present study, the same paradigm was used because of evidence that estrogen also stimulates GnRH receptors in metestrous or diestrous rats (Lloyd and Childs 1988
GnRH Regulation of Pituitary Leptin
To learn if estrogen and GnRH affected the gonadotropin content of leptin mRNA-bearing cells, diestrous rats were stimulated for 24 hr with estrogen and then treated for 1 hr with GnRH. In groups treated with both hormones, there were significant increases in the percentages of AP cells with leptin mRNA and LHß or FSHß, which shows the potential of these reproductive hormones. Neither hormone was effective by itself. At this point, we cannot rule out the possibility that the increase could have been by mitotic activity, as GnRH is mitogenic for gonadotropes (Childs and Unabia 2001
GnRH effects on expression of cellular leptin mRNA and proteins were studied in proestrous rats, which express maximal numbers of GnRH receptors (Lloyd and Childs 1988 The final set of studies compared basal and GnRH-mediated secretion in cells from diestrous, proestrous, and pregnant female rats. If one compares the percentages of leptin-bearing cells in different physiological states with their secretory activity, there was also good correlation between the abundance of leptin protein-bearing cells in the population and their basal and GnRH-stimulated responses.
The possibility that leptin secretion is regulated by a neuroendocrine route suggests that this protein may have a secretory pathway distinct from that of adipocyte leptin. Insulin-mediated leptin secretion from adipocytes is considered to be via constitutive pathways, although a subpopulation of leptin vesicles may be secreted by a regulated pathway (Bradley et al. 2001
Plasticity in the Site(s) of Production of Pituitary Leptin
Changes in the expression of GH proteins by AP cells does not vary significantly with the stage of the cycle (Childs et al. 2000
In male rats or cycling female rats, adding the percentages of leptin cells that contain each hormone brings the values to between 87 and 103% of leptin-bearing cells. One must recognize, however, that in cycling female rats, 5070% of gonadotropes are bihormonal (Childs et al. 1987
Overlap in storage may also apply to the populations from lactating or pregnant rats in which adding the percentages brings the total to 130% or 156% of leptin-bearing cells. Overlap in storage of gonadotropins with or without GH has not yet been studied or described for these experimental groups; however, other "stimulated states" such as castration show an increase in the proportion of bihormonal gonadotropes to nearly 100% of gonadotropes (Childs 1995 Leptin production by somatogonadotropes might help explain the plasticity evident during pregnancy, especially if the shift reflects a reduction in GH expression by this subset. Future studies of GH expression after pregnancy are needed to learn more about this phenomenon. The average percentages of GH cells in pregnant rat cultures are not lower than those normally seen in diestrous female rats.
In light of the probable overlap in storage of gonadotropins and GH in leptin-bearing cells, future studies will be needed to learn if other pituitary cell types change expression of leptin with the reproductive cycle. In our previous studies (McDuffie et al. 2004
To conclude, this study has demonstrated gender and cyclic differences in leptin expression, which could be regulated by GnRH supported by estrogen feedback. In females, the highest basal and GnRH-mediated leptin secretory activity was found in pituitary cells from proestrous or pregnant rats. This proves that pituitary leptin can be secreted and strengthens evidence for a role for pituitary leptin during these physiological states. Collectively, this study and our previous study (McDuffie et al. 2004
Funding for this study was provided to G.V. Childs by the National Science Foundation (Grant IBN 0240907), National Institutes of Health (NIH; Grant R03 HD-44875), and the National Center for Research Resources (NCRR, NIH; Grant 1 P20 RR-020146). In addition, funding for overseas training was provided to Dr. Kudo by the Ministry of Education, Culture, Sports, Science and Technology of Japan for Private Universities. Contents of the study are the sole responsibility of the authors and do not necessarily represent the official views of NCRR or NIH. The authors appreciate the help of Dr. Alex Pierson, Roche Life Sciences, with the Universal Probe system for leptin mRNA. The authors thank A.F. Parlow and the Hormone Distribution Office, National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK, NIH) for the antisera to rat growth hormone and Dr. J.G. Pierce for the anti-bovine LHß.
Presented in part as a poster at the 86th Annual Meeting of the Endocrine Society, New Orleans, LA, June 1619, 2004, and in a platform session at the 39th Annual Meeting for the Society for the Study of Reproduction, Omaha, NE, July 31, 2006. Received for publication August 7, 2006; accepted September 28, 2006
Barash IA, Cheung CC, Weigle DS, Ren H, Kabigting EB, Kuijper JL, Clifton DK, et al. (1996) Leptin is a metabolic signal in the reproductive system. Endocrinology 137:31443147[Abstract] Bédécarrats GY, Kaiser UB (2003) Differential regulation of gonadotropin subunit gene promoter activity by pulsatile gonadotropin-releasing hormone (GnRH) in perifused LBT2 cells: role of GnRH receptor concentration. Endocrinology 144:18021811 Belchetz PE, Plant TM, Nakai Y, Keogh EJ, Knobil E (1978) Hypophysial responses to continuous and intermittent delivery of hypothalamic gonadotropin-releasing hormone. Science 202:631633 Bradley RL, Cleveland KA, Cheatham B (2001) The adipocyte as a secretory organ: mechanisms of vesicle transport and secretory pathways. Rec Prog Horm Res 56:329358[Abstract] Burger LL, Dalkin AC, Aylor KW, Haisenleder DJ, Marshall JC (2002) GnRH pulse frequency modulation of gonadotropin subunit gene transcription in normal gonadotropesassessment by primary transcript assay provides evidence for roles of GnRH and follistatin. Endocrinology 143:32433249 Chehab PF, Lim ME, Lu R (1996) Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat Genet 12:318320[CrossRef][Medline] Childs GV (1995) Division of labor among gonadotropes. Vitam Horm 50:215286[Medline] Childs GV (2006) Gonadotropes and lactotropes. In Neill J, Knobil E, eds. Physiology of Reproduction. New York, Elsevier, 14831579 Childs GV, Iruthayanathan M, Akhter N, Unabia G, Whitehead-Johnson B (2005) Bipotential effects of estrogen on growth hormone synthesis and storage in vitro. Endocrinology 146:17801788 Childs GV, Naor Z, Hazum E, Tibolt R, Westlund KN, Hancock MB (1983a) Cytochemical characterization of pituitary target cells for biotinylated gonadotropin releasing hormone. Peptides 4:549555[CrossRef][Medline] Childs GV, Naor Z, Hazum E, Tibolt R, Westlund KM, Hancock MB (1983b) Localization of biotinylated gonadotropin releasing hormone on pituitary monolayer cells with avidin-biotin peroxidase complexes. J Histochem Cytochem 31:14221425[Abstract] Childs GV, Unabia G (2001) Epidermal growth factor and gonadotropin releasing hormone stimulate proliferation of enriched populations of pituitary gonadotropes. Endocrinology 142:847854 Childs GV, Unabia G, Lloyd J (1992a) Recruitment and maturation of small subsets of luteinizing hormone (LH) gonadotropes during the estrous cycle. Endocrinology 130:335345[Abstract] Childs GV, Unabia G, Lloyd JM (1992b) Maturation of FSH gonadotropes during the rat estrous cycle. Endocrinology 131:2936[Abstract] Childs GV, Unabia G, Miller BT (1994b) Cytochemical detection of GnRH binding sites on rat pituitary cells with LH, FSH and GH antigens during diestrous upregulation. Endocrinology 134:19431951[Abstract] Childs GV, Unabia G, Rougeau D (1994a) Cells that express luteinizing hormone (LH) and follicle stimulating hormone (FSH) beta (ß) subunit mRNAs during the estrous cycle: the major contributors contain LHß, FSHß and/or growth hormone. Endocrinology 134:990997[Abstract] Childs GV, Unabia G, Tibolt R, Lloyd JM (1987) Cytological factors that support non-parallel secretion of LH and FSH during the estrous cycle. Endocrinology 121:18011813[Abstract] Childs GV, Unabia G, Wu P (2000) Differential expression of growth hormone messenger ribonucleic acid by somatotropes and gonadotropes in male and cycling female rats. Endocrinology 141:15601570 Clayton RN (1989) Gonadotrophin releasing hormone: its actions and receptors. J Endocrinol 120:1119[Medline] Conn PM (1994) The molecular mechanism of gonadotropin-releasing hormone action in the pituitary. In Knobil E, Neill J, eds. The Physiology of Reproduction, 2nd ed. New York, Raven Press, 18151832 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||