Journal of Histochemistry and Cytochemistry
  Search:   
    >> Advanced Search

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact

Originally published as JHC exPRESS on August 4, 2008.
doi:10.1369/jhc.2008.951673
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jhc.2008.951673v1
56/11/1003    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seegmiller, R. E.
Right arrow Articles by Fernandes, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seegmiller, R. E.
Right arrow Articles by Fernandes, R. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Histochemistry and Cytochemistry
Volume 56 (11): 1003-1011, 2008
Copyright ©The Histochemical Society, Inc.

The Heterozygous Disproportionate Micromelia (Dmm) Mouse: Morphological Changes in Fetal Cartilage Precede Postnatal Dwarfism and Compared With Lethal Homozygotes Can Explain the Mild Phenotype

Robert E. Seegmiller, Brandon D. Bomsta, Laura C. Bridgewater, Cindy M. Niederhauser, Carolina Montaño, Sterling Sudweeks, David R. Eyre and Russell J. Fernandes

Department of Physiology and Developmental Biology (RES,BDB,SS) and Department of Microbiology and Molecular Biology (LCB,CMN,CM), Brigham Young University, Provo, Utah, and Department of Orthopedics and Sports Medicine, University of Washington, Seattle, Washington (DRE,RJF)

Correspondence to: Robert E. Seegmiller, PhD, Department of Physiology and Developmental Biology, 593 WIDB, Brigham Young University, Provo, UT 84602. E-mail: Robert_seegmiller{at}byu.edu


   Summary
Top
 Summary
Introduction
 Materials and Methods
 Results
 Discussion
 Literature Cited
 
The disproportionate micromelia (Dmm) mouse has a mutation in the C-propeptide coding region of the Col2a1 gene that causes lethal dwarfism when homozygous (Dmm/Dmm) but causes only mild dwarfism observable ~1-week postpartum when heterozygous (Dmm/+). The purpose of this study was 2-fold: first, to analyze and quantify morphological changes that precede the expression of mild dwarfism in Dmm/+ animals, and second, to compare morphological alterations between Dmm/+ and Dmm/Dmm fetal cartilage that may correlate with the marked skeletal differences between mild and lethal dwarfism. Light and electron transmission microscopy were used to visualize structure of chondrocytes and extracellular matrix (ECM) of fetal rib cartilage. Both Dmm/+ and Dmm/Dmm fetal rib cartilage had significantly larger chondrocytes, greater cell density, and less ECM per unit area than +/+ littermates. Quantitative RT-PCR showed a decrease in aggrecan mRNA in Dmm/+ vs +/+ cartilage. Furthermore, the cytoplasm of chondrocytes in Dmm/+ and Dmm/Dmm cartilage was occupied by significantly more distended rough endoplasmic reticulum (RER) compared with wild-type chondrocytes. Fibril diameters and packing densities of +/+ and Dmm/+ cartilage were similar, but Dmm/Dmm cartilage showed thinner, sparsely distributed fibrils. These findings support the prevailing hypothesis that a C-propeptide mutation could interrupt the normal assembly and secretion of Type II procollagen trimers, resulting in a buildup of pro{alpha}1(II) chains in the RER and a reduced rate of matrix synthesis. Thus, intracellular entrapment of pro{alpha}1(II) seems to be primarily responsible for the dominant-negative effect of the Dmm mutation in the expression of dwarfism. (J Histochem Cytochem 56:1003–1011, 2008)

Key Words: chondrodysplasia • extracellular matrix • disproportionate micromelia • Col2a1 • C-propeptide


   Introduction
Top
 Summary
 Introduction
Materials and Methods
 Results
 Discussion
 Literature Cited
 
THE COL2A1 gene codes for type II collagen, the most abundant collagen in the extracellular matrix (ECM) of cartilage. Type II collagen is a homotrimer of {alpha}1(II) subunits, which are synthesized as propeptides containing both N- and C-terminal extensions. After pro{alpha}1(II) chains are translated and secreted into the rough endoplasmic reticulum (RER), the C-propeptides associate through hydrophobic and electrostatic interactions, with assistance from specific chaperones (Lamande and Bateman 1999Go; Tasab et al. 2000Go). Subsequently, intra- and interchain disulfide bonds form and help stabilize the homotrimer during folding of the triple helical domains (Pace et al. 2001Go; Hulmes 2002Go; Boudko and Engel 2004Go). Once folding is accomplished, pro{alpha}1(II) trimers are transported to the ECM, where their N- and C-propeptides are enzymatically cleaved, and the triple helical domains are incorporated and cross-linked into fibrils (Kuivaniemi et al. 1997Go).

Mutations in the human COL2A1 gene lead to a variety of chondrodysplasia phenotypes (Kuivaniemi et al. 1997Go). The majority of the mutations identified disrupt the repetitive Gly-X-Y pattern in the triple helical domain. Five disease-causing mutations, however, have been identified in the C-propeptide coding region of COL2A1. They all cause phenotypically overlapping chondrodysplasias: Stickler syndrome (Ahmad et al. 1995Go), vitreoretinopathy with phalangeal epiphyseal dysplasia (Richards et al. 2002Go), spondyloperipheral dysplasia (Zabel et al. 1996Go), achondrogenesis II–hypochondrogenesis (Mortier et al. 2000Go), and spondyloepiphyseal dysplasia (Unger et al. 2001Go). The C-propeptide mutations are presumed to cause disease by producing chains that disturb the assembly of triple-helical procollagen molecules.

The disproportionate micromelia (Dmm) mutation provides a mouse model of the cartilage abnormalities resulting from human COL2A1 C-propeptide mutations. The Dmm mouse has a three-nucleotide deletion mutation in the Col2a1 C-propeptide coding region, which replaces lysine and threonine with asparagine (KT206,207N) in a highly conserved region of the protein (Pace et al. 1997Go). Homozygotes (Dmm/Dmm) have severe skeletal dysplasia and cleft palate secondary to micrognathic tongue obstruction, and they die shortly after birth from pulmonary hypoplasia caused by rib skeletal dysplasia (Brown et al. 1981Go; Foster et al. 1994Go; Ricks et al. 2002Go). In contrast, heterozygotes (Dmm/+) appear normal at birth but exhibit a mild dwarfism beginning at ~1-week postpartum (Brown et al. 1981Go). Osteoarthritis-like changes in knee joint cartilage appear at ~2 months of age (Seegmiller et al. 2001Go; Bomsta et al. 2006Go).

Because the Dmm mutation affects the C-propeptide domain, it has been suggested that this mutation could interfere with the initiation of triple helical assembly. Alternatively, it might not prevent the initial assembly into trimers but block the export of trimers containing one or more defective pro{alpha}1(II) chains into the ECM (Pace et al. 1997Go). We recently reported that, in Dmm/Dmm fetuses, {alpha}1(II) chains are localized in chondrocytes only intracellularly, and Type II collagen is absent from the ECM (Fernandes et al. 2003Go). In Dmm/+ fetuses, Type II collagen was detected both intra- and extracellularly, but the ECM had 45% less Type II collagen than in wild types, in which no intracellular {alpha}1(II) chains were detected (Fernandes et al. 2003Go). These results suggest that, in Dmm/+ animals, only wild-type pro{alpha}1(II) chains are incorporated into trimeric molecules in the RER. Unrestricted assembly of defective and wild-type chains into trimers and then cellular retention of all trimers containing a defective chain would be expected to reduce the amount of Type II collagen in the ECM by seven eighths (Lee et al. 1989Go).

The purpose of this study was 2-fold: first, to analyze and quantify morphological changes that precede the expression of mild dwarfism in Dmm/+ animals, and second, to compare morphological alterations between Dmm/+ and Dmm/Dmm fetal cartilages to understand the basis of their mild vs lethal dwarfism. We observed abnormalities in Dmm/+ cartilage before but did not quantify them in comparison with Dmm/Dmm cartilages.


   Materials and Methods
Top
 Summary
 Introduction
 Materials and Methods
Results
 Discussion
 Literature Cited
 
Tissue Acquisition and Processing
Heterozygous mice were used to generate two timed pregnancies. Seven fetuses were removed from one dam and six from the other on gestation Day 18 (vaginal plug detection = Day 0). The genotype of each fetus was determined from tail sample DNA using PCR and restriction enzyme analysis as previously described (Pace et al. 1997Go). Rib cages were removed from three +/+, five Dmm/+, and two Dmm/Dmm fetuses, and the cartilaginous portions were fixed in 3% glutaraldehyde and postfixed in 1% osmium tetroxide. The three lowest ribs were embedded in Spurr's low viscosity embedding resin (Ted Pella; Redding, CA), and the rib that provided the most complete longitudinal section was used for this study (Pace et al. 1997Go). To determine whether the absence of a typical collagenous network in Dmm/Dmm cartilage would have an effect on the retention of proteoglycans in the matrix compared with the Dmm/+ and +/+, the cationic dye ruthenium hexamine trichloride (Hunziker et al. 1982Go; Hauselmann et al. 1994Go) was intentionally left out of this protocol. The exclusion of this cationic dye enabled us to detect thin collagen fibrils in the matrix that otherwise would have been obscured by proteoglycans (Fernandes et al. 2003Go).

Light Microscopy
Plastic longitudinal sections cut 1 µm thick were stained with 1% toluidine blue-azure II solution. Digital photographs of the cartilage at the widest diameter of each rib were taken with a SPOT RT color camera (Diagnostic Instruments; Sterling Heights, MI) attached to an Olympus BX51 light microscope (Center Valley, PA) at a magnification of x400. All cartilage of the rib except the proliferative and hypertrophic cell zones was examined; thus, the specimens consisted primarily of structural cartilage and some cells of the reserve zone.

To determine the cellular area fraction, chondrocytes within a tissue field of 51,625 µm2 (approximately the same area as shown in Figure 1 , Low Mag column) were counted for each sample. To estimate the area that was occupied by ECM, chondrocytes within a tissue field of 4310 µm2 (approximately one half the area shown in Figure 1, High Mag and Matrix Highlighted columns) were outlined on the digital image of each section, and the area of the tissue field occupied by cells was calculated and subtracted from the total area of the tissue field.


Figure 1
View larger version (117K):
[in this window]
[in a new window]

  		Figure 1

Light micrographs of sectioned fetal rib cartilage. Low Mag Column (bar = 50 µm) shows an increase in cellular area fraction in disproportionate micromelia (Dmm)/+ and Dmm/Dmm rib cartilage compared with +/+ cartilage. High Mag column (bar = 10 µm) shows decreased amounts of ECM in Dmm/+ and Dmm/Dmm cartilage relative to +/+ cartilage. Matrix Highlighted column (bar = 10 µm) shows the same images as the High Mag column, but the extracellular matrix (ECM) has been digitally rendered to emphasize and quantify the difference in the amount of matrix per unit area of tissue. Note the decreased toluidine blue/azure II staining in the Dmm/Dmm samples.

 
Electron Microscopy
Sections were cut at 100 nm from the same tissue blocks that provided sections for the light microscopy study, stained with lead citrate and 0.5% uranyl acetate, and viewed under a JEOL 2000 FX transmission electron microscope (Tokyo, Japan). Electron micrographs were taken at x2000 for evaluation of cell size, x7000 for evaluation of chondrocyte structure, and x34,000 for evaluation of the ECM. The negatives were scanned using a Microtek Scan Maker 8700 (Fontana, CA) to obtain digital images. Area measurements were obtained using Adobe Photoshop 7.0 (Adobe; San Jose, CA) to outline selected areas and determine the number of pixels within.

Nine cellular profiles with full-diameter nuclei within each section were randomly chosen and analyzed to determine the area occupied by the entire chondrocyte profile as well as the area occupied by its nucleus, cytoplasm, and dilated RER. The area fraction of cytoplasm occupied by dilated RER was calculated. To determine collagen fibril density in the ECM, four randomly selected tissue fields of 828,240 nm2 each were used to calculate the area of the image occupied by collagen fibrils. The diameter of 24, randomly selected, collagen fibrils from each sample was measured.

Statistical Analysis
A two-way ANOVA was used to compare means for the cell density and ECM measurements collected by light microscopy. ANOVA was also used to compare data collected by electron microscopy, including cell size, percent of cytoplasm occupied by dilated RER, fibril density, and fibril diameter. These data were modeled using a mixed model for each of the genotypes. Based on previous published research, the use of these sample sizes for analyzing the morphological and molecular/biochemical data has permitted rejection of the null hypothesis at the p<0.05 significance level.

IHC
Ribs from +/+, Dmm/+, and Dmm/Dmm Day 18 fetuses were snap frozen in O.C.T. Compound embedding media (Tissue Tek; Torrance, CA) and sectioned at 10 µm thickness. Before staining, sections were fixed in ice cold acetone for 10 min and rinsed with PBS. Samples were incubated with 0.5 U/ml chondroitinase for 30 min, followed by 25% normal goat blocking serum for 20 min. Aggrecan was detected with a polyclonal antibody specific for mouse aggrecan core protein (dilution, 1:1000; Chemicon, Temecula, CA) and TRITC23-conjugated secondary antibody (dilution, 1:1000; Molecular Probes, Eugene, OR). Fluorescently labeled sections were incubated with TO-PRO-3 iodide before coverslipping to stain cell nuclei. Staining was visualized, and images were digitally recorded with an Olympus IX81 confocal microscope.

RNA Extraction and Quantitative RT-PCR
Rib cartilage tissue samples from Day 18 fetal mice, one each from the +/+, Dmm/+, and Dmm/Dmm genotypes, were excised and disrupted using a mortar and pestle and homogenized in TRIzol reagent (Invitrogen; Carlsbad, CA) using a Fisher Scientific Model 550 Sonic Dismembrator (Fremont, CA) at power level 4. The samples were sonicated on ice for four 10-sec intervals with a 30-sec pause between cycles. Total RNA was extracted and precipitated according to the TRIzol reagent manufacturer's protocol. After drying, the RNA was reconstituted in 20 µl of nanopure irradiated water with 0.2 µl of RNase OUT RNase inhibitor (Invitrogen) and stored at –80C. cDNA was synthesized using complete total RNA and the iScript cDNA synthesis kit (BioRad; Hercules, CA) according to manufacturer's protocol. The cDNA was diluted 1:10 and stored at –20C until PCR.

The quantitative RT-PCR was performed on a BioRad My iQ single color real-time PCR detection system. One µl of the RT reaction was used as template along with 12.5 µl of SYBR Green Supermix UDG (Invitrogen), 0.5 µl of 10 µM reverse primer, 0.5 µl of 10 µM forward primer, and 10.5 µl of nanopure water per reaction. Primer sequences were as follows: aggrecan1, GAAGAAGTTCCAGACCATGACAACTCAC (forward) and GGTAGATGCTGTTGACTCGAACCTGTC (reverse); 18S rRNA, CTCGCTCCTCTCCTACTTG (forward) and CGGGTTGGTTTTGATCTGATA (reverse). Five replicates of the samples were analyzed for each genotype and each primer set. The PCR was carried out at 50C for 2 min and 95C for 2 min, followed by 45 cycles of 95C for 15 sec, 67C for 30 sec, and 72C for 30 sec.

The cycle threshold (Ct) values were calculated using the second derivative maximum method. In brief, a Boltzmann Sigmoidal function (with 4000 data points) was used to curve-fit the raw fluorescence values (GraphPad Prism software version 4.0; GraphPad, San Diego, CA). A second derivative curve for the curve-fit data was determined, also using GraphPad Prism. The Ct value used for quantitative analysis was determined by finding the cycle number corresponding to the maximum second derivative value, as described further by Rasmussen (2001)Go. Relative fold mRNA expression was calculated using the 2–{Delta}{Delta}CT method after normalizing to 18S RNA expression (Livak and Schmittgen 2001Go). A two-sample t-test (using Microsoft Excel 2003; Microsoft, Redmond, WA) was used to determine statistical significance. The average detection for the wild type was used to establish 1-fold expression for comparison with the mutant.


   Results
Top
 Summary
 Introduction
 Materials and Methods
 Results
Discussion
 Literature Cited
 
Histological Evaluation of Cartilage
Differences in cellular area fraction were readily apparent on visual inspection of rib cartilage from +/+, Dmm/+, and Dmm/Dmm mice (Figure 1, Low Mag column). On quantifying these differences, the average numbers of chondrocytes within the specified tissue fields (see Materials and Methods section) for +/+, Dmm/+, and Dmm/Dmm mice were 391, 495, and 492, respectively. This represents a 26% increase in cellular area fraction in both Dmm/+ and Dmm/Dmm mutant cartilages compared with +/+ cartilage (Table 1 ).


View this table:
[in this window]
[in a new window]

  		Table 1

Comparison of +/+, Dmm/+, and Dmm/Dmm rib cartilage for differences in cellular and matrix area fraction and in matrix fibril properties (mean ± SE)

 
Consistent with the increased cellular area fraction, the area fraction of ECM was noticeably less in Dmm/+ and Dmm/Dmm compared with +/+ samples (Figure 1, High Mag and Matrix Highlighted columns). Quantifying this area fraction occupied by ECM showed a 45% reduction in Dmm/+ and Dmm/Dmm relative to +/+ samples (Table 1). The Dmm/Dmm sections also showed less metachromatic staining of the ECM than did the Dmm/+ and +/+ sections.

Ultrastructural Evaluation of Cartilage
Comparing electron micrographs of rib chondrocyte sections from +/+, Dmm/+, and Dmm/Dmm animals suggested a difference in cellular area fraction between wild-type and mutant samples (Figure 2 ). Measurement of the cellular area fraction showed that the average area fraction per chondrocyte from +/+ cartilage was 83.5 µm2. By comparison, the average area fraction for Dmm/+ chondrocytes was significantly greater at 109.1 µm2. Dmm/Dmm chondrocytes, with an average area fraction of 107.1 µm2, were also significantly larger than +/+ chondrocytes but were not different from Dmm/+ chondrocytes (Table 1). This represents a 28–31% increase in cellular area fraction in both Dmm/+ and Dmm/Dmm mutant cartilages compared with +/+ cartilage (Table 1).


Figure 2
View larger version (71K):
[in this window]
[in a new window]

  		Figure 2

Transmission electron micrographs of murine fetal rib cartilage. Wild-type (+/+) cartilage shows typical chondrocyte area fraction, whereas the chondrocytes of both heterozygous (Dmm/+) and homozygous (Dmm/Dmm) samples appear larger. The empty looking vacuoles in some of the cells are fixation artifacts. Bar = 10 µm.

 
Chondrocytes from +/+ animals showed RER with only a few slightly distended lumens (Figure 3 ), which on quantitation occupied on average 7.1% of the cytoplasmic area of rib chondrocytes. In contrast, rib cartilage from Dmm/+ fetuses showed significantly more distended RER, which occupied, on average, 19.1% of the cytoplasmic area of the chondrocytes. From Dmm/Dmm mice, even more distended RER was evident, occupying 30.3% of the cytoplasmic area (Table 1). Very little normal-appearing RER was apparent in Dmm/Dmm chondrocytes, and here, the RER distensions were filled with material that was not evident in +/+ or Dmm/+ cells. The Dmm/Dmm chondrocytes also differed from Dmm/+ and +/+ chondrocytes in that the cytosol was less translucent (Figures 2 and 3).


Figure 3
View larger version (36K):
[in this window]
[in a new window]

  		Figure 3

Transmission electron micrographs of murine fetal rib chondrocytes. The cytoplasm of +/+ chondrocytes shows abundant rough endoplasmic reticulum (RER) with only slightly dilated lumens. The RER of both Dmm/+ and Dmm/Dmm chondrocytes shows markedly distended lumens. The material within the RER of Dmm/+ is uniformly stained as in +/+ chondrocytes. In contrast, the material within the RER of Dmm/Dmm chondrocytes appears heterogeneously stained. Bar = 1 µm.

 
The ECM of +/+ and Dmm/+ rib cartilages was similar in containing collagen fibrils of uniform distribution and diameter. The ECM of Dmm/Dmm rib cartilage showed a dramatic decrease in fibril density (Figure 4 ). On quantifying these differences, the percentages of ECM occupied by collagen fibrils for +/+, Dmm/+, and Dmm/Dmm cartilage were 38%, 38%, and 10%, respectively. The average diameter of collagen fibrils in +/+ and Dmm/+ cartilages was ~16 nm compared with 9 nm in Dmm/Dmm cartilage (Table 1).


Figure 4
View larger version (35K):
[in this window]
[in a new window]

  		Figure 4

Transmission electron micrographs of the ECM of murine fetal rib cartilage. The collagen fibrils in the ECM of +/+ cartilage are uniformly distributed. The fibrils in Dmm/+ cartilage did not differ from those of +/+; however, collagen fibrils in Dmm/Dmm cartilage occupy markedly less of the total extracellular space, showing a decrease in fibrillar area fraction. Bar = 200 nm.

 
Aggrecan Localization and Aggrecan Expression Levels
Because the area fraction of the ECM was found to be reduced (Table 1), IHC was used to determine whether aggrecan is retained within the RER. For both +/+ and Dmm/+ samples, aggrecan was localized predominantly in the ECM (Figure 5 ). Aggrecan, therefore, did not seem to be retained in the ER of Dmm/+ chondrocytes.


Figure 5
View larger version (115K):
[in this window]
[in a new window]

  		Figure 5

IHC localization of aggrecan in murine fetal rib cartilage. An antibody specific for mouse aggrecan core protein shows abundant extracellular staining in both +/+ and Dmm/+ samples. In the Dmm/Dmm cartilage, ECM localization of aggrecan is more irregular, likely because of the disorganization of the collagenous fibrillar network in the ECM.

 
To determine whether reduced synthesis of aggrecan could account for the reduced ECM area fraction, quantitative RT-PCR of aggrecan mRNA from Dmm/+ and +/+ cells was performed. As seen in Figure 6 , aggrecan mRNA levels in Dmm/+ cells were 22.7 ± 4.3% (SEM) of the levels present in +/+ cells, a highly significant difference (p<0.0001).


Figure 6
View larger version (14K):
[in this window]
[in a new window]

  		Figure 6

Quantitative RT-PCR assay of aggrecan in murine fetal rib cartilage. There was a striking reduction in aggrecan mRNA expression levels in Dmm/+ cartilage (Dmm/+). A 5.9-fold excess aggrecan mRNA was transcribed in +/+ cartilage than in Dmm/+ cartilage. This decrease was statistically significant. p<0.0001, using the two-tailed t-test.

 

   Discussion
Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
Literature Cited
 
Endochondral bone growth is the result of a complex interplay between cell proliferation, chondrocyte hypertrophy, and ECM synthesis in the growth plate (Wilsman et al. 1996Go; Kronenberg 2003Go). One might predict, therefore, that inability of growth plate chondrocytes to secrete a major ECM precursor such as type II collagen would decrease the volume of the ECM, resulting in disproportionate dwarfism. Indeed, rib cartilages from Dmm/+ and Dmm/Dmm mice were found in this study to have a 26–31% increase in the cellular area fraction and a 45% less ECM per unit area than +/+ cartilage.

This increased cellular area fraction and decreased ECM per unit area could be caused by increased cell proliferation. It is more likely, however, that they result from a reduction in ECM deposition caused by the Dmm mutation. This explanation is more likely because it is consistent with the presence of distended RER and intracellular localization of type II collagen (Fernandes et al. 2003Go) in chondrocytes of Dmm/+ and Dmm/Dmm cartilage, suggesting that defective pro{alpha}1(II) chains are being retained by the cell. Normally, pro{alpha}1(II) chains associate in the RER into trimers through interactions of their C-propeptide domains and fold linearly or in sections into a triple helix before being secreted to the ECM (Hulmes 2002Go). An inability of defective pro{alpha}1(II) chains to be incorporated into a collagen trimer while in the RER is expected to inhibit their secretion (Zabel et al. 1996Go).

The rate at which three wild-type pro{alpha}1(II) chains are able to come together and form a collagen trimer in the chondrocytes of Dmm/+ animals would be greatly reduced if competitive interactions with defective pro{alpha}1(II) chains retained in the RER were to occur. Moreover, the likelihood of three normal pro{alpha}1(II) chains associating with each other would continue to decrease as the Dmm/+ chondrocytes mature because of the increasing amount of defective pro{alpha}1(II) chains accumulating in the RER. This model may account for the approximately normal skeletal size of Dmm/+ animals at birth and for the occurrence of dwarfism 1-week postpartum (Brown et al. 1981Go). Perhaps fetal Dmm/+ animals have not yet accumulated large amounts of defective pro{alpha}1(II) chains in the RER and are therefore able to secrete sufficient Type II collagen trimers to achieve relatively normal bone elongation. However, as the chondrocytes age and the amount of defective pro{alpha}1(II) chains in the RER increases, chondrocytes may be compromised in their ability to assemble and secrete enough collagen trimers for structural integrity and for normal bone elongation, resulting in mild dwarfism.

Our results showed a similar amount of matrix per unit area in Dmm/+ and Dmm/Dmm cartilage. However, a major difference between these two genotypes is the decreased density of collagen fibrils in the ECM of Dmm/Dmm. This paucity of fibrils likely leads to the "fragile and liquid character of the growth plate observed during dissection" of these animals (Brown et al. 1981Go). The alignment of chondrocytes perpendicular, not parallel, to the long axis of the bone (Brown et al. 1981Go), resulting in short, thick bones (Seegmiller et al. 1971Go), may be a consequence of no matrix integrity. This hypothesis is supported by the observation that Dmm/+ mice, despite having a similar decrease in the amount of ECM, have normal collagen fibril density in cartilage and normal growth plate organization.

The hypothesis that the RER is distended by retained abnormal pro{alpha}1(II) chains is supported by recent biochemical and IHC findings that Type II collagen is 45% decreased in the ECM of Dmm/+ cartilage, and Type II collagen chains accumulate in the dilated RER (Fernandes et al. 2003Go). These morphology data are consistent with this 45% decrease in Dmm/+ mice and lack of Type II collagen in the matrix of Dmm/Dmm cartilage (Fernandes et al. 2003Go). The decreased metachromatic staining in Dmm/Dmm ECM suggests that a collagen network is necessary to retain proteoglycans during tissue processing for histology (Brown et al. 1981Go; Seegmiller et al. 1988Go). The decreased and irregular pattern of IHC localization of aggrecan in the ECM of Dmm/Dmm cartilage (Figure 5) supports this.

The decreased amount of ECM in Dmm/+ cartilage with a normal collagen fibril density suggests other ECM proteins are also decreased in amount in proportion to Type II collagen. Indeed, quantitative RT-PCR showed a 77% decrease in the level of aggrecan mRNA in Dmm/+ compared with +/+ cartilage (Figure 6). Because intracellular accumulation of aggrecan in the RER was not obvious (Figure 5), this suggested that the low area fraction of the ECM in Dmm/+ cartilage was caused by a decreased synthesis of aggrecan, likely in response to the accumulation of mutant pro{alpha}1(II) collagen chains in the RER. Other murine matrix defects that do not show a dilated RER may be informative on this issue. Mice heterozygous for a null Type II collagen gene produce normal amounts of ECM yet show a decrease in the density of collagen fibrils (Li et al. 1995Go; Hyttinen et al. 2001Go), suggesting that other ECM proteins are secreted at approximately normal rates. In the cmd mouse, a null mutation in the aggrecan gene causes dwarfism in homozygotes similar to Dmm (Watanabe et al. 1994Go; Krueger et al. 1999Go), with a marked decrease in total ECM volume yet an unusually dense collagen fibril network (Seegmiller et al. 1988Go). In cmd, therefore, normal amounts of collagen seem to be secreted despite the lack of aggrecan secretion.

At least one of the five reported cases of COL2A1C-propeptide mutation resulted in distended RER "filled with fine granular material" by electron microscopy (Zabel et al. 1996Go). This human mutation caused shortened limbs, shortened trunk, and midface hypoplasia reminiscent of the Dmm/+ phenotype. The heterozygous Dmm/+ mouse is a relevant model for human COL2A1 C-propeptide mutations that result in congestion of the RER, with abnormal pro{alpha}1(II) chains that cannot assemble into trimers.


   Acknowledgments
 
This research was supported by National Institutes of Health Grants AR-48839 (to LCB), AR-47568 (to RES), and AR-52896 (to RJF).

The authors thank Dr. John Gardner and Mike Standing of Brigham Young University (BYU) Microscopy Laboratory for technical assistance and advice, Dr. Dennis Eggett and Heather Van Duker of BYU Statistics Department for assisting with statistical analysis, and Richard Low for manuscript preparation. R.J.F thanks the Friday Harbor Laboratories of the University of Washington for making available a creative environment to write and revise this manuscript.


   Footnotes
 
Received for publication April 17, 2008; accepted July 15, 2008


   Literature Cited
Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Literature Cited
 

Ahmad NN, Dimascio J, Knowlton RG, Tasman WS (1995) Stickler syndrome. A mutation in the nonhelical 3' end of type II procollagen gene. Arch Ophthalmol 113:1454–1457[Abstract/Free Full Text]

Bomsta BD, Bridgewater LC, Seegmiller RE (2006) Premature osteoarthritis in the disproportionate micromelia (Dmm) mouse. Osteoarthritis Cartilage 14:477–485[CrossRef][Medline]

Boudko SP, Engel J (2004) Structure formation in the c terminus of type iii collagen guides disulfide cross-linking. J Mol Biol 335:1289–1297[CrossRef][Medline]

Brown KS, Cranley RE, Greene R, Kleinman HK, Pennypacker JP (1981) Disproportionate micromelia (dmm): an incomplete dominant mouse dwarfism with abnormal cartilage matrix. J Embryol Exp Morphol 62:165–182[Medline]

Fernandes RJ, Seegmiller RE, Nelson WR, Eyre DR (2003) Protein consequences of the col2a1 c-propeptide mutation in the chondrodysplastic dmm mouse. Matrix Biol 22:449–453[CrossRef][Medline]

Foster MJ, Caldwell AP, Staheli J, Smith DH, Gardner JS, Seegmiller RE (1994) Pulmonary hypoplasia associated with reduced thoracic space in mice with disproportionate miromelia (dmm). Anat Rec 238:454–462[CrossRef][Medline]

Hauselmann HJ, Fernandes RJ, Mok SS, Schmid TM, Block JA, Aydelotte MB, Kuettner KE, et al. (1994) Phenotypic stability of bovine articular chondrocytes after long-term culture in alginate beads. J Cell Sci 107:17–27[Abstract]

Hulmes DJ (2002) Building collagen molecules, fibrils, and suprafibrillar structures. J Struct Biol 137:2–10[CrossRef][Medline]

Hunziker EB, Herrmann W, Schenk RK (1982) Improved cartilage fixation by ruthenium hexamine trichloride (RHT). A prerequisite for morphometry in growth cartilage. J Ultrastruct Res 81:1–12[CrossRef][Medline]

Hyttinen MM, Toyras J, Lapvetelainen T, Lindblom J, Prockop DJ, Li SW, Arita M, et al. (2001) Inactivation of one allele of the type ii collagen gene alters the collagen network in murine articular cartilage and makes cartilage softer. Ann Rheum Dis 60:262–268[Abstract/Free Full Text]

Kronenberg HM (2003) Developmental regulation of the growth plate. Nature 423:332–336[CrossRef][Medline]

Krueger RC Jr, Kurima K, Schwartz NB (1999) Completion of the mouse aggrecan gene structure and identification of the defect in the cmd-bc mouse as a near complete deletion of the murine aggrecan gene. Mamm Genome 10:1119–1125[CrossRef][Medline]

Kuivaniemi H, Tromp G, Prockop DJ (1997) Mutations in fibrillar collagens (types I, II, III, and XI), fibril-associated collagen (type IX), and network-forming collagen (type X) cause a spectrum of diseases of bone, cartilage, and blood vessels. Hum Mutat 9:300–315[CrossRef][Medline]

Lamande SR, Bateman JF (1999) Procollagen folding and assembly: the role of endoplasmic reticulum enzymes and molecular chaperones. Semin Cell Dev Biol 10:455–464[CrossRef][Medline]

Lee B, Vissing H, Ramirez F, Rogers D, Rimoin D (1989) Identification of the molecular defect in a family with spondyloepiphyseal dysplasia. Science 244:978–980[Abstract/Free Full Text]

Li SW, Prockop DJ, Helminen H, Fassler R, Lapvetelainen T, Kiraly K, Peltarri A, et al. (1995) Transgenic mice with targeted inactivation of the col2 alpha 1 gene for collagen ii develop a skeleton with membranous and periosteal bone but no endochondral bone. Genes Dev 9:2821–2830[Abstract/Free Full Text]

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402–408[CrossRef][Medline]

Mortier GR, Weis M, Nuytinck L, King LM, Wilkin DJ, De Paepe A, Lachman RS, et al. (2000) Report of five novel and one recurrent col2a1 mutations with analysis of genotype-phenotype correlation in patients with a lethal type ii collagen disorder. J Med Genet 37:263–271[Abstract/Free Full Text]

Pace JM, Kuslich CD, Willing MC, Byers PH (2001) Disruption of one intra-chain disulphide bond in the carboxyl-terminal propeptide of the proalpha1(i) chain of type i procollagen permits slow assembly and secretion of overmodified, but stable procollagen trimers and results in mild osteogenesis imperfecta. J Med Genet 38:443–449[Abstract/Free Full Text]

Pace JM, Li Y, Seegmiller RE, Teuscher C, Taylor BA, Olsen BR (1997) Disproportionate micromelia (dmm) in mice caused by a mutation in the c-propeptide coding region of col2a1. Dev Dyn 208:25–33[CrossRef][Medline]

Rasmussen R (2001) Quantification on the LightCycler instrument. In Meuer S, Wittwer C, Nakagawara K, eds. Rapid Cycle Real-time PCR: Methods and Applications. Heidelberg, Springer, 21–34

Richards AJ, Morgan J, Bearcroft PW, Pickering E, Owen MJ, Holmans P, Williams N, et al. (2002) Vitreoretinopathy with phalangeal epiphyseal dysplasia, a type ii collagenopathy resulting from a novel mutation in the c-propeptide region of the molecule. J Med Genet 39:661–665[Abstract/Free Full Text]

Ricks JE, Ryder VM, Bridgewater LC, Schaalje B, Seegmiller RE (2002) Altered mandibular development precedes the time of palate closure in mice homozygous for disproportionate miromelia: an oral clefting model supporting the pierre-robin sequence. Teratology 65:116–120[CrossRef][Medline]

Seegmiller RE, Brown KS, Chandrasekhar S (1988) Histochemical, immunoflourescence, and ultrastructural differences in fetal cartilage among three genetically distinct chondrodystrophic mice. Teratology 38:579–592[CrossRef][Medline]

Seegmiller RE, Fraser FC, Sheldon H (1971) A new chondrodystrophic mutant in mice. Electron microscopy of normal and abnormal chondrogenesis. J Cell Biol 48:580–593[Abstract/Free Full Text]

Seegmiller RE, Ryder VM, Jackson R, Rodriguez RR, Vu H, Babcock W, Poole AR, et al. (2001) Comparison of two collagen mutant mouse lines that serve as models of early-onset osteoarthritis in human chondrodysplasia. Osteoarthritis Cartilage 9:S15

Tasab M, Batten MR, Bulleid NJ (2000) Hsp47: a molecular chaperone that interacts with and stabilizes correctly-folded procollagen. EMBO J 19:2204–2211[CrossRef][Medline]

Unger S, Korkko J, Krakow D, Lachman RS, Rimoin DL, Cohn DH (2001) Double heterozygosity for pseudoachondroplasia and spondyloepiphyseal dysplasia congenita. Am J Med Genet 104:140–146[CrossRef][Medline]

Watanabe H, Kimata K, Line S, Strong D, Gao LY, Kozak CA, Yamada Y (1994) Mouse cartilage matrix deficiency (cmd) caused by a 7 bp deletion in the aggrecan gene. Nat Genet 7:154–157[CrossRef][Medline]

Wilsman NJ, Farnum CE, Leiferman EM, Fry M, Barreto C (1996) Differential growth by growth plates as a function of multiple parameters of chondrocytic kinetics. J Orthop Res 14:927–936[CrossRef][Medline]

Zabel B, Hilbert K, Stoss H, Superti-Furga A, Spranger J, Winterpacht A (1996) A specific collagen type ii gene (col2a1) mutation presenting as spondyloperipheral dysplasia. Am J Med Genet 63:123–128[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
 NEJMHome page
P. Smits, A. D. Bolton, V. Funari, M. Hong, E. D. Boyden, L. Lu, D. K. Manning, N. D. Dwyer, J. L. Moran, M. Prysak, et al.
Lethal Skeletal Dysplasia in Mice and Humans Lacking the Golgin GMAP-210
N. Engl. J. Med., January 21, 2010; 362(3): 206 - 216.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jhc.2008.951673v1
56/11/1003    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seegmiller, R. E.
Right arrow Articles by Fernandes, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seegmiller, R. E.
Right arrow Articles by Fernandes, R. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact