Originally published as JHC exPRESS on November 26, 2007. doi:10.1369/jhc.7A7331.2007
Volume 56 (3): 285-293, 2008 Copyright ©The Histochemical Society, Inc. Immunocytochemistry and Laser Capture Microdissection for Real-time Quantitative PCR Identify Hindbrain Neurons Activated by Interaction Between Leptin and Cholecystokinin
Division of Metabolism, Endocrinology, and Nutrition, Department of Medicine (DLW,MWS,JEB,DGB) and Department of Biological Structure (DGB), University of Washington, Seattle, Washington, and Medical Research Service, Department of Veterans Affairs Puget Sound Health Care System, Seattle, Washington (LSB,JEB,DGB) Correspondence to: Diana L. Williams, University of Washington, Harborview Medical Center, 325 9th Avenue, Box 359675, Seattle, WA 98104. E-mail: dianalw{at}u.washington.edu
Current evidence suggests that leptin reduces food intake in part by enhancing the hindbrain neuronal response to meal-related gastrointestinal signals, including cholecystokinin (CCK), but the phenotypes of the relevant cells are not known. To identify neurons that participate in this interaction in the rat nucleus of the solitary tract (NTS), we induced c-Fos gene expression in NTS neurons with leptin and CCK. We focused on NTS catecholamine neurons because these cells have been implicated in the feeding response to CCK. Hindbrain sections from rats that received CCK with or without leptin pretreatment were immunostained for c-Fos and tyrosine hydroxylase (TH) by a double immunofluorescence procedure. Leptin pretreatment increased the number of NTS cells expressing c-Fos-like immunoreactivity (cFLI) 3-fold relative to CCK alone, but the number of TH-positive cells with cFLI was increased 6-fold. Next, cells detected by immunofluorescence for TH were collected by laser capture microdissection and pooled for real-time quantitative PCR of c-Fos mRNA. Here, neither le0ptin nor CCK alone affected the relative amount of mRNA in the TH cell–enriched samples, but leptin plus CCK substantially increased c-Fos mRNA content. These histochemical findings identify hindbrain catecholamine cells as potential mediators of the interaction between leptin and CCK. (J Histochem Cytochem 56:285–293, 2008)
Key Words: leptin cholecystokinin catecholamine neurons food intake satiety c-Fos energy homeostasis
THE CONTROL of meal size is considered to reside primarily in the caudal brainstem. Signals arising from the gastrointestinal tract in response to ingested nutrients, such as the gut peptide cholecystokinin (CCK), directly or indirectly activate cells in the hindbrain that promote meal termination (Moran et al. 2001
In this study, we used histochemical techniques to test the hypothesis that hindbrain catecholamine neurons are among several NTS neuronal populations with the potential to mediate the interaction between leptin and CCK, because previous studies have implicated these cells in the feeding response to CCK. Neurons in A2/C2 catecholamine groups of the hindbrain express c-Fos in response to CCK treatment and make up the largest group of CCK-responsive forebrain-projecting cells (Rinaman et al. 1993
Animals Naïve adult male Wistar rats (Charles River; Wilmington, MA) were individually housed in Plexiglass cages in a temperature-controlled room under a 12:12-hr light:dark cycle. Rats were given ad libitum access to water and standard rat chow (Purina 5001; Purina, St. Louis, MO) except where otherwise noted. All procedures conformed to institutional standards of animal care and use as specified in the National Research Council's Guide for the Care and Use of Laboratory Animals and were approved by the Animal Care Committees at the Veterans Administration Puget Sound Health Care System and University of Washington.
Surgery
Drugs
Procedures for Immunofluorescence Colocalization of TH and cFLI
Double Label Immunofluorescence
Quantitative Analysis of Immunostaining
Statistical Analysis
Procedures for Laser Capture of NTS TH Cells and PCR Analysis
LCM of Immunostained Neurons The primers and probes for GAPDH and c-Fos mRNA were designed with the aid of Primer Express version 2.0.0 software (Applied Biosystems). GAPDH mRNA was measured using 1 µM forward (5'-GCCAGCCTCGTCTCATAGACA-3') and 1 µM reverse (5'-GTCCGATACGGCCAAATCC-3') primers in conjunction with 0.4 µM TaqMan probe primer (VIC-5'-ATGGTGAAGGTCGGTGTG-3'). c-Fos mRNA was measured with 1 µM forward (GAGCCCTCCTCTGACTCACTGA) and 1 µM reverse (TGCCTTCTCTGACTGCTCACA) primers in conjunction with 0.4 µM Taqman probe primer (TGCCTTCTCTGACTGCTCACA). The TH mRNA TaqMan probe and primers were obtained from Applied Biosystems (4331182 reference Rn00562500_m1). All measurements were made using the Applied Biosystems Taqman Universal PCR Master Mix and the ABI Prism 7000 Sequence Detection System. The samples were incubated first at 50C for 2 min and then at 95C for 10 min and were subjected to 40 cycles of alternating 95C for 15 sec, followed by 60C for 1 min. Relative amounts of TH and c-Fos mRNA were calculated using the Comparative CT method that generates relative TH and c-Fos mRNA levels adjusted for the GAPDH endogenous control mRNA. The data points for each animal represent the average of triplicate measurements.
Statistical Analysis
Immunofluorescence Colocalization of TH and cFLI The immunofluorescence procedure revealed neurons containing cFLI and TH in the NTS, the known location of A2/C2 catecholamine cell groups. The cFLI staining was concentrated in neuronal nuclei, whereas TH immunofluorescence was distributed in the neuronal perikarya and fibers, which were the expected locations of the respective proteins (Figure 1 ). This different morphological distribution of cFLI and TH facilitated the visual identification of double-labeled cells. As expected, there was no visual difference in the numbers and intensity of immunostained TH-positive neurons among the treatment groups (Figures 1A and 1B). CCK administration in the absence of leptin pretreatment under the conditions of this protocol had a minimal effect on numbers of cFLI in the NTS (Figure 1D). In contrast, animals that received ICV leptin pretreatment showed a robust NTS c-Fos response to CCK (Figure 1E), similar to previous reports (Emond et al. 1999
We next determined whether the effect of leptin pretreatment to enhance the cFLI response to CCK occurred preferentially in NTS TH-positive neurons. In the absence of ICV leptin pretreatment, few TH-positive cells in the NTS contained cFLI, as shown by the paucity of immunostained neuronal nuclei (Figure 1G). By contrast, after ICV leptin pretreatment, many TH-positive cells contained nuclei immunostained for cFLI (Figure 1H). Quantitative analysis of the NTS indicated that ICV leptin pretreatment strongly increased the number of c-Fos-positive cells in the NTS of rats after a subthreshold peripheral dose of CCK administration compared with this dose of CCK given after an ICV vehicle injection [t(7) = 4.41; p<0.01; Figure 2A ]. There was no difference in the numbers of TH-positive NTS neurons among the treatment groups [t(7) = 1.11; Figure 2B]. However, ICV leptin pretreatment resulted in a 6-fold increase in the number of TH-positive neurons that contained nuclear cFLI staining [t(7) = 6.21; p<0.001; Figure 2C]. Leptin pretreatment also markedly increased the percentage of the TH cell population that expressed c-Fos in response to CCK from 7% to 40% [t(7) = 6.00; p<0.001; Figure 3A ]. The population of NTS neurons that expressed cFLI in response to either CCK alone or to leptin and CCK in combination was not limited to catecholaminergic neurons. On the contrary, TH-positive neurons made up only 5% of all cFLI-positive cells in the NTS of rats in the vehicle/CCK group, and the stimulatory effect of leptin on the percentage of NTS cFLI-positive cells that were also TH-positive did not achieve statistical significance [t(7) = 2.00; p = 0.08; Figure 3B].
Laser Capture of NTS TH Cells and PCR Analysis Our rapid immunostaining procedure before LCM enabled the immunocytochemical identification of TH-positive neurons in the NTS (Figure 4A ). TH-positive cells were marked for picking by laser capture (Figure 4B), and after they were picked (150–200 cells/rat), the marked cells could be visually detected by fluorescence after they had been transferred to the Arcturus plastic sample caps (Figure 4C). Examination of the NTS section after cell picking revealed holes where the labeled cells had been removed (Figure 4D). The success of this immuno-laser capture procedure for obtaining enriched samples of TH-positive neurons was confirmed by real-time quantitative PCR of these RNA extracts, which showed substantially higher levels of TH mRNA in laser-captured samples of TH-immunoreactive cells compared with samples of nearby cells that were negative for TH immunoreactivity [t(3) = 2.81; p<0.05; Figure 5 ].
Analysis of the extracted RNA from the different treatment groups showed that neither the leptin/vehicle (i.e., leptin alone) nor the vehicle/CCK (i.e., CCK alone) groups showed a significant increase in c-Fos mRNA in TH cell–enriched NTS samples compared with the vehicle/vehicle group. In animals that received ICV leptin treatment before IP CCK, however, the level of c-Fos mRNA in the TH cell–enriched samples was increased 2.5-fold [interaction between leptin and CCK: F(1,15) = 4.32; p<0.05; Figure 6
]. The combination of the ICV leptin and peripheral CCK treatments resulted in significantly increased levels of c-Fos mRNA in NTS TH cells compared with either leptin or CCK alone (p<0.01).
The significant new finding of this study was that A2/C2 catecholamine neurons in the rat NTS are preferentially activated, as measured by expression of c-Fos mRNA and immunoreactive cFLI protein, during the synergistic interaction of peripheral CCK and ICV leptin on food intake. This finding was based in part on histochemical techniques that identified cFLI immunostaining in NTS neurons that contained immunoreactive TH. In addition, we used the technique of immuno-LCM to collect enriched populations of NTS TH-positive neurons for real-time quantitative PCR. The latter studies confirmed the visual and quantitative findings of the immunostaining studies, showing that the synergistic interaction between the actions of these peptides also increases mRNA levels for c-Fos in this population of A2/C2 catecholamine neurons. Growing evidence suggests that negative feedback adiposity signals, such as leptin, reduce food intake, at least in part by enhancing the satiety response to meal-related signals, including CCK. To better understand the basis for this interaction, we studied the hypothesis that catecholamine neurons in the NTS integrate the effects of leptin and CCK. Using a combination of LCM and real-time quantitative PCR, we report that third-ICV leptin pretreatment markedly enhances the effect of IP CCK administration to increase expression of the gene encoding c-Fos, a marker of neuronal activation, in NTS catecholaminergic neurons. Furthermore, our histochemical results showed that when leptin was given before CCK, the activation of TH neurons (relative to animals that received CCK without leptin pretreatment) was twice as great as was observed in unselected NTS neurons (i.e., 6-fold vs 3-fold). This result establishes TH neurons as selective targets of the interaction between leptin and CCK in the NTS. It is also clear from our immunohistochemical results, however, that other non-TH-positive cell populations within the NTS are involved in the integration of leptin and CCK signaling, and it will be important to identify their phenotypes in the future.
The use of LCM to analyze c-Fos mRNA expression in catecholamine neurons of the NTS is a novel aspect of this study. This strategy allowed us to ask whether NTS catecholamine cells are involved in the leptin-induced potentiation of the c-Fos response to CCK in the NTS using a combination of rapid immunostaining with LCM. This technique has been shown to be a valid method for obtaining mRNA from an immunohistochemically defined subpopulation of cells selected from heterogeneous tissue, and the protocol that we used here has also been validated (Fend et al. 1999
The specific mechanisms through which leptin enhances the c-Fos response to CCK in NTS TH cells are not yet clear, but the available data support the hypothesis that leptin potentiates the stimulatory effect of CCK on these neurons through actions in both the hindbrain and the forebrain. Recent electrophysiological studies have shown that the majority of TH neurons in the mouse NTS receive direct stimulatory input from vagal afferent fibers (Appleyard et al. 2005
It is widely accepted that leptin acts within the hypothalamus to reduce food intake, and previous evidence indicates that it can enhance the response of unselected NTS neurons to CCK through descending projections from the forebrain. Our laboratory has published evidence that the NTS c-Fos response to CCK can be modulated by leptin action restricted to the hypothalamus (Morton et al. 2005
Although our findings do not address the mechanism by which TH neurons could mediate the synergistic effects of leptin and CCK on food intake, they nevertheless represent an important contribution to understanding the basis for this interaction. Rinaman (2003)
A priority for future work is to elucidate the mechanisms through which activation of NTS neurons leads to inhibition of food intake. In addition to regulating the activity of parasympathetic motor neurons supplying the gastrointestinal tract, NTS neurons project widely throughout the brain and innervate areas involved in diverse aspects of food intake control. For example, several hypothalamic subnuclei (e.g., the paraventricular nucleus and lateral hypothalamus) involved in food intake and autonomic regulation receive projections from NTS neurons. Areas involved in perception of food reward (e.g., nucleus accumbens), and nuclei involved in the perception of and response to aversive stimuli (e.g., parabrachial nucleus, amygdala) are also innervated by the NTS, as are nuclei that control oromotor aspects of ingestion (i.e., the motor nuclei of the facial, trigeminal, and hypoglossal nerves) (Sawchenko 1983
This material is based on work supported by the Office of Research and Development, Medical Research Service, Veterans Health Administration of the Department of Veterans Affairs. D.G.B. is the recipient of a Department of Veterans Affairs Senior Research Career Scientist Award at the Department of Veterans Affairs Puget Sound Health Care System. This work was also supported by a National Institutes of Health (NIH) individual National Research Service Award fellowship (to DLW), NIH Grants DK-52989, DK-12829, DK-68340, and NS-32273 (to MWS), and the Diabetes and Endocrinology Research Center (DERC) and Clinical Nutrition Research Unit of the University of Washington. The authors thank David Caldwell, Jenny Kam, Loan Nguyen, and the DERC Cellular and Molecular Imaging Core at the University of Washington for expert technical assistance.
Received for publication August 1, 2007; accepted November 13, 2007
Appleyard SM, Kobayashi K, Okano H, Low MJ, Andresen MC (2005) Opioids Inhibit Sensory Afferent Activation of Tyrosine Hydroxylase Neurons in the Nucleus of the Solitary Tract. Washington, DC, Society for Neuroscience Barrachina MD, Martinez V, Wang L, Wei JY, Tache Y (1997) Synergistic interaction between leptin and cholecystokinin to reduce short-term food intake in lean mice. Proc Natl Acad Sci USA 94:10455–10460 Blevins JE, Eakin TJ, Murphy JA, Schwartz MW, Baskin DG (2003) Oxytocin innervation of caudal brainstem nuclei activated by cholecystokinin. Brain Res 993:30–41[CrossRef][Medline] Blevins JE, Schwartz MW, Baskin DG (2004) Evidence that paraventricular nucleus oxytocin neurons link hypothalamic leptin action to caudal brain stem nuclei controlling meal size. Am J Physiol Regul Integr Comp Physiol 287:R87–96 Edwards GL, Ladenheim EE, Ritter RC (1986) Dorsomedial hindbrain participation in cholecystokinin-induced satiety. Am J Physiol 251:R971–977[Medline] Emond M, Schwartz GJ, Ladenheim EE, Moran TH (1999) Central leptin modulates behavioral and neural responsivity to CCK. Am J Physiol 276:R1545–1549[Medline] Fend F, Emmert-Buck MR, Chuaqui R, Cole K, Lee J, Liotta LA, Raffeld M (1999) Immuno-LCM: laser capture microdissection of immunostained frozen sections for mRNA analysis. Am J Pathol 154:61–66 Figlewicz DP, Evans SB, Murphy J, Hoen M, Baskin DG (2003) Expression of receptors for insulin and leptin in the ventral tegmental area/substantia nigra (VTA/SN) of the rat. Brain Res 964:107–115[CrossRef][Medline] Fitzsimons JT (1998) Angiotensin, thirst, and sodium appetite. Physiol Rev 78:583–686 Flynn MC, Plata-Salaman CR (1999) Leptin (OB protein) and meal size. Nutrition 15:508–509[CrossRef][Medline] Grill HJ, Schwartz MW, Kaplan JM, Foxhall JS, Breininger J, Baskin DG (2002) Evidence that the caudal brainstem is a target for the inhibitory effect of leptin on food intake. Endocrinology 143:239–246 Hay-Schmidt A, Helboe L, Larsen PJ (2001) Leptin receptor immunoreactivity is present in ascending serotonergic and catecholaminergic neurons of the rat. Neuroendocrinology 73:215–226[CrossRef][Medline] Hosoi T, Kawagishi T, Okuma Y, Tanaka J, Nomura Y (2002) Brain stem is a direct target for leptin's action in the central nervous system. Endocrinology 143:3498–3504 Kahler A, Geary N, Eckel LA, Campfield LA, Smith FJ, Langhans W (1998) Chronic administration of OB protein decreases food intake by selectively reducing meal size in male rats. Am J Physiol 275:R180–185[Medline] Moran TH, Baldessarini AR, Salorio CF, Lowery T, Schwartz GJ (1997) Vagal afferent and efferent contributions to the inhibition of food intake by cholecystokinin. Am J Physiol 272:R1245–1251[Medline] Moran TH, Ladenheim EE, Schwartz GJ (2001) Within-meal gut feedback signaling. Int J Obes Relat Metab Disord 25(suppl 5):S39–41[CrossRef] Morton GJ, Blevins JE, Williams DL, Niswender KD, Gelling RW, Rhodes CJ, Baskin DG, et al. (2005) Leptin action in the forebrain regulates the hindbrain response to satiety signals. J Clin Invest 115:703–710[CrossRef][Medline] Morton GJ, Cummings DE, Baskin DG, Barsh GS, Schwartz MW (2006) Central nervous system control of food intake and body weight. Nature 443:289–295[CrossRef][Medline] Rinaman L (2003) Hindbrain noradrenergic lesions attenuate anorexia and alter central cFos expression in rats after gastric viscerosensory stimulation. J Neurosci 23:10084–10092 Rinaman L, Hoffman GE, Dohanics J, Le WW, Stricker EM, Verbalis JG (1995) Cholecystokinin activates catecholaminergic neurons in the caudal medulla that innervate the paraventricular nucleus of the hypothalamus in rats. J Comp Neurol 360:246–256[CrossRef][Medline] Rinaman L, Verbalis JG, Stricker EM, Hoffman GE (1993) Distribution and neurochemical phenotypes of caudal medullary neurons activated to express cFos following peripheral administration of cholecystokinin. J Comp Neurol 338:475–490[CrossRef][Medline] Sawchenko PE (1983) Central connections of the sensory and motor nuclei of the vagus nerve. J Auton Nerv Syst 9:13–26[CrossRef][Medline] Strader AD, Woods SC (2005) Gastrointestinal hormones and food intake. Gastroenterology 128:175–191[CrossRef][Medline]
This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||