This Article Free Full Text Free Full Text Abstract Full Text (PDF) Free Full Text All Versions of this Article: jhc.2009.953026v1 57/5/477    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dietrich, D. Articles by Kristiansen, G. Search for Related Content PubMed PubMed Citation Articles by Dietrich, D. Articles by Kristiansen, G. Social Bookmarking                         What's this?

Analysis of DNA Methylation of Multiple Genes in Microdissected Cells From Formalin-fixed and Paraffin-embedded Tissues

Dimo Dietrich, Ralf Lesche, Reimo Tetzner, Manuel Krispin, Jörn Dietrich, Wolfgang Haedicke, Matthias Schuster and Glen Kristiansen

Epigenomics AG, Berlin, Germany (DD,RL,RT,MK,JD,MS); MVZ Vorpommern GmbH, Pasewalk, Germany (WH); and Institute of Clinical Pathology, University Hospital Zurich, Switzerland (GK)

Correspondence to: Dimo Dietrich, Epigenomics AG, Kleine Präsidentenstr. 1, 10178 Berlin, Germany. E-mail: dimo.dietrich{at}epigenomics.com

	Summary

Top Summary Introduction Materials and Methods Results Discussion Literature Cited

 
A procedure for simultaneous quantification of DNA methylation of several genes in minute amounts of sample material was developed and applied to microdissected formalin-fixed and paraffin-embedded breast tissues. The procedure is comprised of an optimized bisulfite treatment protocol suitable for samples containing only few cells, a multiplex preamplification and subsequent locus specific reamplification, and a novel quantitative bisulfite sequencing method based on the incorporation of a normalization domain into the PCR product. A real-time PCR assay amplifying repetitive elements was established to quantify low amounts of bisulfite-treated DNA. Ten prognostic and diagnostic epigenetic breast cancer biomarkers (PITX2, RASSF1A, PLAU, LHX3, PITX3, LIMK1, SLITRK1, SLIT2, HS3ST2, and TFF1) were analyzed in tissue samples obtained from two patients with invasive ductal carcinoma of the breast. The microdissected samples were obtained from several areas within the tumor tissue, including intraductal and invasive carcinoma, adenosis, and normal ductal epithelia of adjacent normal tissue, as well as stroma, tumor infiltrating lymphocytes, and adipose tissue. Overall, reliable quantification was possible for all genes. For most genes, increased DNA methylation in invasive and intraductal carcinoma cells compared with other tissue components was observed. For TFF1, decreased methylation levels were observed in tumor cells. (J Histochem Cytochem 57:477–489, 2009)

Key Words: DNA methylation • laser microdissection • multiplexed analysis • quantitative bisulfite sequencing • formalin-fixed and paraffin-embedded tissues • breast cancer

	Introduction

Top Summary Introduction Materials and Methods Results Discussion Literature Cited

 
DNA METHYLATION has been shown to be involved in fundamental biological processes such as development and cell differentiation (Robertson 2005). Aberrant DNA methylation has been reported to play a major role in carcinogenesis (Jones and Baylin 2002), suggesting that DNA methylation analysis may be a valuable source for cancer biomarkers. As of today, regulation of gene expression using CpG island methylation has been described for many genes. However, the biological function at the cellular level is often poorly understood because the individual contributions of different cell types within the tissue context to the overall methylation signal of a biological sample are difficult to resolve. This is mostly because of the lack of suitable methods, which allow for quantitative methylation analysis of minute template amounts, for instance, as obtained from laser-microdissected cells.

In cancer research, the development of laser microdissection (LMD) systems has addressed the dilemma that any analysis, irrespective if genomic, transciptomic, or proteomic, is susceptible to contamination by non-neoplastic cells. This contamination might mask tumor-specific alterations. Material resulting from LMD is suitable for a wide range of downstream applications such as loss of heterozygosity studies, gene expression analysis, and a variety of proteomic approaches (Esposito 2007). Despite all conceptional advantages of microdissected samples, the use of LMD is mostly limited to very specialized research questions that cannot be addressed by alternative procedures. The main reasons are that LMD is time consuming, labor intensive, and usually yields only tiny amounts of highly specific analytes. Hence, for DNA analysis, only a limited amount of template DNA can be expected from these sample types. This amount is further correlated to the size of the microdissected areas, which defines the resolution of the method for elucidating the biological heterogeneity within a tumor. An additional challenge has been encountered for samples from formalin-fixed and paraffin-embedded tissues (FFPETs), which often contain fragmented DNA of poor quality for molecular biological applications such as PCR (Srinivasan et al. 2002). Because of these limitations, only a limited number of studies have been published describing high-resolution DNA methylation analysis within tumor tissues (Hui et al. 2000; Cui et al. 2001; Umbricht et al. 2001; Lehmann et al. 2002; Nakayama et al. 2003; Lodygin et al. 2004; Woodson et al. 2004; Di Vinci et al. 2005; Greenspan et al. 2006; Hanson et al. 2006; Henrique et al. 2006; Yan et al. 2006; Aitchison et al. 2007; Rodriguez-Canales et al. 2007). However, these studies either allowed only for a qualitative analysis of the presence of methylated DNA or they required a high number of microdissected cells (usually >1000 cells) to analyze a single or only a few biomarkers.

The analysis of DNA methylation using sequencing requires an additional bisulfite conversion step, which results in deamination of all unmethylated cytosines to uracil, leaving only methylated cytosines unaltered (Frommer et al. 1992). Bisulfite treatment has been reported to cause DNA loss because of degradation under harsh chemical conditions (Tanaka and Okamoto 2007) and the requirement for an additional purification step. Genome-wide amplified DNA is a suitable template for many applications (i.e., single nucleotide polymorphism analysis) (Paez et al. 2004). However, until now, no genome-wide DNA amplification method retaining CpG methylation has been reported. Genome-wide amplification of bisulfite-treated DNA using degenerated primers (Yang et al. 2007) is hampered because of the fragmented template derived from the bisulfite treatment and the fixation of the tissue. Thus, quantitative DNA methylation analysis in minute amounts of material, in particular from FFPETs, represents a challenge.

To overcome the limitations described above, a procedure for analyzing several biomarkers simultaneously and quantitatively in a very small number of cells is reported herein. This procedure combines an optimized protocol for bisulfite treatment of minute amounts of template DNA with a multiplexed preamplification of all loci of interest in parallel, followed by a separate reamplification of the single loci. To improve quantitative analysis, a novel method for quantitative bisulfite sequencing based on the Sanger method was developed. This quantitative bisulfite sequencing method is based on the incorporation of a domain into the PCR product, which is subsequently used for signal normalization.

Furthermore, a quantitative real-time PCR based on the amplification of a repetitive element was established, which allows for the accurate quantification of minute sample amounts on a single copy level. Such an assay is needed to exclude samples that only contain single copies of the human genome and that therefore might not yield a biologically reasonable result.

The developed procedure was applied to analyze the methylation of 11 loci quantitatively in microdissected cells from FFPET from two cases of invasive ductal carcinoma of the breast. From these two cases, 54 tissue areas with different cell components, including ductal carcinoma in situ (DCIS), invasive ductal carcinoma (IDC), normal ducts, adenosis, stroma, adipose tissue, and tumor infiltrating lymphocytes (TILs), were microdissected and analyzed.

Besides the known methylation biomarkers PITX2, PLAU, TFF1, RASSF1A, LIMK1, SLIT2, SLITRK1, and HS3ST2 (Foekens et al. 1990; Schwartz et al. 1991; Martin et al. 1995; Ruibal et al. 1999; Bae et al. 2004; Muller et al. 2004; Pakneshan et al. 2004,2005; Shinozaki et al. 2005; Hoque et al. 2006; Lesche et al. 2006; Maier et al. 2007; Nimmrich et al. 2008), the promoter regions of the genes LHX3 and PITX3 were analyzed. These genes show high sequence similarity to, or are potentially regulated by, PITX2 (Charles et al. 2005). Within the PITX2 gene, two alternative promoters that regulate the transcript variants A and B (promoter A) and variant C (promoter C) were studied.

	Materials and Methods

Top Summary Introduction Materials and Methods Results Discussion Literature Cited

 
Patients and Tissue
Tissue specimens from 13 breast cancer patients diagnosed at the Institute of Pathology, Charité University Hospital, Berlin, Germany, were analyzed for this study. Appropriate consent was obtained from all patients.

LMD and Lysis
Three-µm sections were prepared from FFPETs for subsequent LMD sample preparation. Sections were mounted on membrane-covered slides (Leica Microsystems; Wetzlar, Germany) and briefly stained with hematoxylin. Two-µm reference sections were prepared from the same block and stained with hematoxylin and eosin. LMD was performed using a Leica Microsystems device. Microdissected samples were captured in caps of 500-µl PCR tubes filled with 25 µl lysis buffer [50 mM Tris-HCl, pH 8, 1 mM EDTA, 0.5% (v/v) Tween 20 (Sigma-Aldrich; St. Louis, MO), 10 ng/µl poly-dA (Roche; Basel, Switzerland), and 3 g/liter proteinase K (Carl Roth; Karlsruhe, Germany)]. LMD samples were centrifuged briefly and incubated at 60C for 8 hr. Two µl proteinase K solution (300 g/liter) was added, and the samples were incubated for another 4 hr at 60C.

DNA from non-dissected tissue sections was prepared as follows: three sections (10 µm each) were transferred into a 2-ml tube and spun down (5 min at 16,000 x g). On hundred ninety µl lysis buffer was added, and the sections were incubated for 10 min at 65C and 1000 rpm in a thermomixer. Ten µl proteinase K solution (30 g/liter) was added, and the samples were incubated for 24 hr at 60C and 1000 rpm in a thermomixer.

DNA Preparation, Bisulfite Conversion, and Purification
Bisulfite-treated reference DNA for quantitative real-time PCR was prepared as previously described (Tetzner et al. 2007). Two µg human genomic DNA from whole blood (Promega; Madison, WI) was applied to the bisulfite reaction and subsequently quantified by UV spectrophotometry using a Nanodrop ND-1000 spectral photometer (Nanodrop Technologies; Wilmington, DE).

Unmethylated DNA was prepared by multiple displacement amplification (MDA), a genome-wide amplification method (Dean et al. 2002). For the preparation of MDA DNA mixtures with defined methylation ratios, a portion of this amplificate was treated with SssI methyltransferase (New England Biolabs; Ipswich, MA) in the presence of S-adenosyl-methionine, according to the manufacturer's instructions, and mixed with the unmethylated amplificate to give mixtures with 0%, 5%, 10%, 25%, 50%, 75%, and 100% methylation. Two µg of each of these mixtures was bisulfite treated using the EpiTect kit (Qiagen; Hilden, Germany).

DNA from washed research sperm (NW Andrology and Cryobank; Spokane, WA) was extracted using the QIAamp DNA Mini Kit (Qiagen). Artificially methylated sperm DNA was prepared using SssI methyltransferase as described above. Bisulfite treatment of sperm and artificially methylated sperm DNA was done using the EpiTect kit. Mixtures of bisulfite-treated sperm DNA and bisulfite-treated artificially methylated sperm DNA were prepared (ratios of 0%, 25%, 50%, 75%, and 100%).

Bisulfite-converted DNA from whole tissue sections was prepared by applying 20 µl lysate (see above) directly to the EpiTect kit protocol. The preparation was done according to the manufacturer's instructions (FFPE tissue protocol), with the following modifications: the bisulfite reaction mixture was mixed with 310 µl buffer BL and 250 µl ethanol (99.9%) before the transfer to the EpiTect spin column.

The DNA concentration of MDA DNA mixtures, mixtures of sperm and artificially methylated sperm DNA, and DNA from whole tissue sections was determined using the MER9 long terminal repeat (LTR) quantification assay as described below.

Bisulfite treatment of LMD samples was performed in 500-µl PCR tubes with the following composition: 20–25 µl tissue lysate, 38 µl dissolved bisulfite mix (from EpiTect kit), and 6 µl diethylene glycol dimethyl ether (Merck; Darmstadt, Germany) containing 125 g/liter Trolox (Sigma-Aldrich). The reaction mixture was incubated for 5 min at 99C, 22 min at 60C, 3 min at 99C, 87 min at 60C, 3 min at 99C, and 177 min at 60C in a PCR cycler. Purification of the DNA was achieved using Zymo-Spin IC silica membrane columns (Zymo Research; Orange, CA). One hundred sixty-six µl buffer AVL containing poly-A (both Qiagen) and the reaction mixture was transferred to the column. The empty bisulfite reaction tube was washed with 90 µl buffer AVL, which was subsequently transferred to the spin column. The mixture on the column was mixed properly and incubated for 10 min at room temperature. Two hundred fifty µl ethanol (99.9%) was added to the column. The column was vortexed briefly and centrifuged for 2 min at 16,000 x g. The column was transferred into a new collection tube (Qiagen), loaded with 500 µl buffer BD (from EpiTect Kit), and centrifuged 2 min at 16,000 x g. The column was transferred into a new collection tube, and the bound DNA was washed consecutively with 500 µl buffer AW1 and AW2 (both Qiagen). Each buffer was removed by spinning the columns 2 min at 16,000 x g, and the respective collection tube was discarded. Finally, the column was centrifuged again for 2 min at 16,000 x g without buffer to completely remove the wash buffer. Bisulfite-converted DNA was eluted into a 1.5-ml tube using 12.5 µl water (preheated to 50C). After incubation for 1 min at room temperature, the DNA was eluted by centrifugation for 1 min at 6000 x g. The elution step was repeated once. The total eluate was transferred into a 200-µl PCR tube. The empty 1.5-ml elution tube was washed with 22 µl water, which was also transferred to the PCR tube. One µl of eluted DNA from LMD samples was applied to the MER9 LTR real-time PCR quantification (as described below).

PCR Amplification
Multiplexed PCR preamplification of bisulfite DNA was performed in a 50-µl reaction volume in the presence of 2 U HotStar Taq polymerase (Qiagen), 1x PCR buffer (Qiagen), 0.2 mM each dNTP (dGTP, dATP, dCTP, dTTP; Fermentas, Burlington, Canada), and 0.05 µM each of the 22 primers (Table 1 ). This preamplification product (0.5 µl) was applied to further PCR reamplification of each single locus. Reamplification was done in a 25-µl scale (1 U HotStar Taq polymerase, 1x PCR buffer, 0.2 mM each dNTP, 0.5 µM both primers). Amplifications were performed using the following temperature profile: 15 min at 95C and 50 (preamplification) and 45 cycles (reamplification), respectively, with 20 sec at 95C, 45 sec at 58C, and 30 sec at 72C per cycle.

PCR was performed using a 7900HT Fast Real-Time PCR system (Applied Biosystems; Foster City, CA) using the following temperature profile: 10 min at 95C and 45 cycles with 15 sec at 95C and 60 sec at 60C (PLAU), 62C (PITX2), or 58C (TFF1), respectively. Methylation scores were calculated as previously described (Lehmann and Kreipe 2004).

Real-time PCR Quantification of Bisulfite-converted DNA From Microdissected Samples (MER9 LTR Assay)
Real-time PCR quantification of small sample amounts was done in 20-µl volumes with the following composition: 1x PCR buffer with passive ROX reference (Eurogentec), 1 U HotGoldStar Taq polymerase (Eurogentec), 0.2 mM each dNTP (dTTP, dATP, dGTP, and dCTP, Fermentas), 4 mM MgCl₂ (Eurogentec), 0.6 µM each primer (forward: GGTTTTATAGTTTTTAGAGTTGAGAGTT, reverse: CATCCCTTCTTTTCCCATAA), and 0.2 µM detection probe (HEX-AATACTAATAACTAACTTACTATTAAT-BHQ1). The detection probe contained modified cytidines (LNA). PCR was performed using a 7900HT Fast Real-Time PCR system (Applied Biosystems) using the following temperature profile: 10 min at 95C and 45 cycles with 15 sec at 95C and 45 sec at 60C.

Sequencing and Raw Data Processing
ExoSAP-IT (1.5 µl; GE Healthcare, Chalfont St. Giles, UK) was added to 3.5 µl of PCR product and incubated for 45 min at 37C and 15 min at 95C. Cycle sequencing was performed in a total volume of 20 µl with the following composition: 5 µl ExoSAP-IT digested PCR product, 1 µl BigDye Terminator v3.1 (Applied Biosystems), 4 µl buffer [320 mM Tris-HCl, pH 9, 6 mM MgCl₂, 10% (v/v) Sulfolan (Merck)], 5 µl dNTP mixture (0.02 mM dATP, dGTP, dCTP, and dTTP each), and 0.5 µM sequencing primer. The reaction was incubated for 2 min at 96C and 25 cycles with 30 sec at 96C, 15 sec at 55C, and 4 min at 60C in a thermocycler MultiCycler PTC 225 Tetrad (Bio-Rad Laboratories; Hercules, CA). The cycle sequencing product was purified using the DyeEx 96 kit (Qiagen) according to the manufacturer's recommendations. Ten µl Hi-Di formamide (Applied Biosystems) was added to the cycle sequencing product, which was subsequently analyzed using the 3730 DNA Analyzer (Applied Biosystems). ABI sequencing electropherograms were converted to .txt files using BioEdit 6.0.7 software (Isis Pharmaceuticals; Carlsbad, CA) and imported into a spreadsheet. The trace containing the methylation information was visualized, and the normalization signal was identified. For all samples, electropherograms were aligned using the normalization signals in the primer tails. The signals were normalized by integrating the signals of the normalization tail and by dividing each data point of the electropherogram by this reference value. The signals of the CpG sites of completely methylated DNA were used as a reference to identify the CpG positions in the LMD samples. The maximum intensity in the region ± 30 data points from the respective peak in the reference trace was defined as methylation peak maximum in the LMD sample. Thirty data points surrounding each identified peak maximum within each trace were integrated to obtain the methylation score for the respective CpG.

	Results

Top Summary Introduction Materials and Methods Results Discussion Literature Cited

 
The optimized workflow for DNA methylation analysis of multiple genes in microdissected cells from FFPETs is summarized in Figure 1 . Besides the sample lysis, bisulfite conversion, and the subsequent purification, the workflow is comprised of the steps as described in the following paragraphs.

View larger version (11K): [in this window] [in a new window]   Figure 1 Flowchart of the procedure for analysis of DNA methylation in laser microdissection (LMD) samples.

View larger version (11K): [in this window] [in a new window]   Figure 2 Response curve of the MER9 long terminal repeat (LTR) quantification assay in the range of 12,500–0.07 copies of the human genome (bisulfite converted). Shown are means of six replicates ± SD.

Quantitative Bisulfite Sequencing
During the locus-specific reamplification PCR, a normalization signal was incorporated into the PCR product using modified primers. This normalization signal enables the accurate quantification of the methylation level of the respective locus in a given sample. After bisulfite treatment, the converted DNA contains cytosines only at positions that were originally methylated (Figure 3I ). The converted DNA is amplified using reverse primers containing guanosines at their 5' end, leading to an incorporation of cytosines into the PCR product (Figure 3II). These additional cytosines at the 3' end of the PCR product are present in each PCR product molecule (Figure 3III) and can be used for methylation signal normalization.

View larger version (16K): [in this window] [in a new window]   Figure 3 Principle of the quantitative bisulfite sequencing method using a normalization domain. (I) Bisulfite conversion: cytosine deaminates to uracil, whereas methylated cytosines remain unaffected. (II) PCR with reverse primers containing the normalization domain. (III) Sequencing of PCR product.

To confirm the results of the quantitative sequencing method, an independent technology, the real-time PCR based QAMA technology (Lehmann et al. 2002; Lehmann and Kreipe 2004; Zeschnigk et al. 2004), was used as a comparative methodology. DNA preparations from 13 FFPET breast tumor specimens were analyzed for three loci (PITX2 promoter A, PLAU, and TFF1) to evaluate the procedure using samples that fully reflect the DNA quality that is to be expected in LMD sample material from FFPET. The results obtained by quantitative sequencing and from QAMA assay analysis showed high concordance (Figure 4 ), thus showing that FFPET samples can be analyzed reliably.

View larger version (11K): [in this window] [in a new window]   Figure 4 Correlation of methylation results determined by quantitative sequencing and quantitative real-time PCR methylation analysis (QAMA assay), respectively. Shown are results from three loci (PITX2 promoter A, PLAU, and TFF1) in 13 breast cancer tumors. y-axis, means of triplicate QAMA measurements ± SD; x-axis, quantitative sequencing (single measurement).

View larger version (15K): [in this window] [in a new window]   Figure 5 Results of QAMA for 11 loci from a total DNA equivalent of 100 diploid cells processed using the described procedure (starting with multiplex PCR preamplification). Mixtures of bisulfite-converted DNA from sperm and artificially methylated DNA from sperm were analyzed. Shown are means (±SD) of three independently processed replicates. Note that LIMK1 and TFF1 extensive methylation was found in sperm; therefore, it is not possible to use this material to evaluate the dose-response characteristics.

View larger version (70K): [in this window] [in a new window]   Figure 6 Exemplified procedure on LMD specimens. Histologically distinct areas of interest were identified from a patient with diagnosed invasive ductal carcinoma using a hematoxylin-stained section (reference section). One area with invasive tumor cells (IDCs) and two regions with ductal carcinoma in situ (DCIS1 and DCIS2) are depicted. Microdissection was carried out using hematoxylin-stained sections that were prepared adjacent to the reference section. After DNA preparation and bisulfite conversion, the DNA was quantified (copies of the bisulfite-converted human genome) using the MER9 LTR assay, and the methylation of 11 loci was measured in each LMD sample. nd, failed analysis of single loci within one LMD sample.

View larger version (38K): [in this window] [in a new window]   Figure 7 Summary of results for six loci (PITX2 promoters A and C, TFF1, PLAU, PITX3, and LHX3) in 46 microdissected samples from breast cancer patients A and B. The number of the original paraffin block from which the LMD sample came and the number of genome copies quantified using the MER9 LTR assay are listed above each LMD sample.

View larger version (40K): [in this window] [in a new window]   Figure 8 Methylation of five genes (SLITRK1, LIMK1, SLIT2, HS3ST2, and RASSF1A) in 46 microdissected samples from breast cancer patients A and B. The number of the original paraffin block from which the LMD sample came and the number of genome copies quantified using the MER9 LTR assay are listed above each LMD sample.

	Discussion

Top Summary Introduction Materials and Methods Results Discussion Literature Cited

 
DNA methylation alterations are among the most promising candidates for biomarker research. Allowing for precise analysis of methylation patterns from minute amounts of microdissected materials would further open up new possibilities to use DNA methylation as a tissue biomarker. In this study, a procedure is described that allows for the simultaneous quantitative analysis of DNA methylation of several loci in a very limited number of cells from LMD samples of archival FFPETs. This method includes an optimized protocol for bisulfite conversion and subsequent purification. After bisulfite conversion, two consecutive PCR reactions for amplification of the loci of interest were performed. In this study, 11 loci were preamplified in a multiplexed PCR, and each locus was subsequently reamplified in a separate PCR reaction. Thus, this method enables the analysis of the DNA methylation of several genes in one LMD sample. Such multiplexed preamplification has previously been shown to be suitable for target-specific template preamplification in combination with methylation-specific real-time PCR (Fackler et al. 2004,2006).

The incorporation of a normalization signal into the PCR product was previously used to avoid basecaller artifacts (Han et al. 2006) and has herein been proven to be suitable for accurate quantification of DNA methylation. As of today, clone bisulfite sequencing based on the Sanger method is among the most commonly used methods for DNA methylation analysis (Fraga and Esteller 2002; Liu et al. 2004). However, compared with other technologies such as pyrosequencing (Tost et al. 2003; Tost and Gut 2007), accurate quantification is directly correlated with the number of analyzed clones and therefore is time consuming and expensive. Direct sequencing approaches (Lewin et al. 2004) that provide a measure of the degree of methylation at a particular target by comparing cytosine and thymine signals are susceptible to basecaller artifacts and therefore limited in their resolution. Thus, novel methods for accurate quantitative bisulfite sequencing show a significant improvement for methylation analysis.

The exact knowledge about the number of DNA copies in an LMD sample is highly valuable. A measurement originating only from a few copies might not reflect the actual representation of methylated and unmethylated copies. The MER9 LTR real-time PCR assay allows for accurate quantification of the human bisulfite genome down to single copy level. This assay was successfully used to exclude samples with too low DNA content (<25 copies of the human genome) to avoid artifacts resulting from the analysis of low copy numbers.

The quantitative results of the methylation measurement generated with the developed quantitative bisulfite sequencing method were highly concordant with a real-time PCR-based quantitative DNA methylation assay (Lehmann et al. 2002; Lehmann and Kreipe 2004; Zeschnigk et al. 2004). This technique has previously been used to identify PITX2 methylation as a biomarker for outcome prediction in breast cancer (Maier et al. 2007; Nimmrich et al. 2008). The newly developed sequencing method allows for the quantitative methylation analysis of multiple loci in LMD samples from FFPETs, as shown for 11 loci in this study.

The results of the quantitative bisulfite sequencing method are normalized peak areas. To yield the percentage of methylation, these peak areas must be transformed into percentage methylation based on calibration curves that were prepared by applying DNA mixtures with known percentages of methylation. The challenge of preparing suitable calibration mixtures is to use DNAs that, on the one hand, are completely methylated and completely unmethylated and, on the other hand, show a symmetric representation of the analyzed locus. The use of mixtures obtained from genome-wide amplified DNA (MDA DNA) and artificially methylated MDA DNA led in some cases to values <0% and >100%. MDA DNA is partially single stranded and therefore it is not possible to generate completely methylated MDA DNA. However, it is not possible to mix this DNA with completely methylated DNA from natural origin because the loci are not represented symmetrically (Arriola et al. 2007). Thus, sperm DNA was used as model DNA to verify the workflow to ensure that equal copy numbers of the target sequences were present. DNA from sperm bears the potential to be a DNA of natural origin, which should have no major chromosomal rearrangements and has been reported to be unmethylated at many loci (Rakyan et al. 2008). However, DNA from sperm shows methylation for some loci (i.e., LIMK1 and TFF1) and is not suited to calibrate these particular assays. Thus, the individual choice of a suited reference DNA for each loci might further improve the quantitative sequencing method.

In evaluating this method, 54 LMD samples from two selected cases of breast cancer were analyzed. Besides the genes PITX2, RASSF1A, TFF1, PLAU, LIMK1, SLITRK1, SLIT2, HS3ST2 and TFF1, with known aberrant methylation in breast cancer (Foekens et al. 1990; Schwartz et al. 1991; Martin et al. 1995; Ruibal et al. 1999; Bae et al. 2004; Muller et al. 2004; Pakneshan et al. 2004,2005; Shinozaki et al. 2005; Hoque et al. 2006; Lesche et al. 2006; Maier et al. 2007; Nimmrich et al. 2008), aberrant methylation of PITX3 and LHX3 in breast cancer is reported herein for the first time. PITX3 was analyzed because of its high sequence homology with PITX2 and partly redundant function (L'Honore et al. 2007), whereas LHX3 was chosen because regulation by PITX2 was reported (Charles et al. 2005). Although only two patients were analyzed, evidence of increased methylation was found when comparing normal with malignant ducts in both cases. Almost all analyzed genes showed hypermethylation in DCIS and IDC compared with stroma, TILs, normal ducts, adipose tissue, and adenosis tissue. TFF1 showed inverse methylation compared with these genes. No difference between DCIS and IDC was found, indicating that aberrant methylation of the analyzed genes probably occurs early during malignant transformation of the cell. Interestingly, in samples from patient B, most genes showed elevated methylation in normal ducts and TILs compared with adipose tissue and stroma. This could indicate that normal ducts neighboring the tumor might already exhibit some evidence of altered methylation. A reason for this could be a potential field effect, leading to alterations of methylation in normal components adjacent to the tumor or the existence of a subpopulation of cells within the normal ducts, which shows similarities to the tumor cells on an epigenetic level. Such a field has previously been reported (Yan et al. 2006); however, normal components at higher distance from the tumor, or in healthy ducts from patients who did not suffer from breast cancer, would need to be analyzed to explore this. The finding of DNA methylation of the analyzed genes in TILs is unexpected and surprising. However, because TILs showed only low levels of methylation, this finding might hint at the presence of subtypes within TILs, which clearly merits further study.

It is well established that tumor development and progression occurs as an interaction between tumor cells and their stromal environment (for review, see Li et al. 2007; Witz 2008), and the concept of epithelial to mesenchymal transition as a driver of tumor progression has become more important in recent years (Guarino et al. 2007; Soltermann et al. 2008). To carefully analyze this interplay between epithelial and stromal cells in tumor progression, a microdissection is inevitable. For these studies, the described procedure will be a powerful tool to shed further light with higher resolution onto epigenetic mechanisms in cancer pathogenesis. However, this method is suitable for many applications beyond LMD analysis, whenever multiplex analysis of low template amounts is desirable.

	Footnotes

 
Received for publication October 10, 2008; accepted January 5, 2009

	Literature Cited

Top Summary Introduction Materials and Methods Results Discussion Literature Cited

 

Aitchison A, Warren A, Neal D, Rabbitts P (2007) RASSF1A promoter methylation is frequently detected in both pre-malignant and non-malignant microdissected prostatic epithelial tissues. Prostate 67:638–644[CrossRef][Medline]

Arriola E, Lambros MB, Jones C, Dexter T, Mackay A, Tan DS, Tamber N, et al. (2007) Evaluation of Phi29-based whole-genome amplification for microarray-based comparative genomic hybridisation. Lab Invest 87:75–83[CrossRef][Medline]

Bae YK, Brown A, Garrett E, Bornman D, Fackler MJ, Sukumar S, Herman JG, et al. (2004) Hypermethylation in histologically distinct classes of breast cancer. Clin Cancer Res 10:5998–6005[Abstract/Free Full Text]

Charles MA, Suh H, Hjalt TA, Drouin J, Camper SA, Gage PJ (2005) PITX genes are required for cell survival and Lhx3 activation. Mol Endocrinol 19:1893–1903[Abstract/Free Full Text]

Cui J, Rohr LR, Swanson G, Speights VO, Maxwell T, Brothman AR (2001) Hypermethylation of the caveolin-1 gene promoter in prostate cancer. Prostate 46:249–256[CrossRef][Medline]

Dean FB, Hosono S, Fang L, Wu X, Faruqi AF, Bray-Ward P, Sun Z, et al. (2002) Comprehensive human genome amplification using multiple displacement amplification. Proc Natl Acad Sci USA 99:5261–5266[Abstract/Free Full Text]

Di Vinci A, Perdelli L, Banelli B, Salvi S, Casciano I, Gelvi I, Allemanni G, et al. (2005) p16(INK4a) promoter methylation and protein expression in breast fibroadenoma and carcinoma. Int J Cancer 114:414–421[CrossRef][Medline]

Esposito G (2007) Complementary techniques: laser capture microdissection–increasing specificity of gene expression profiling of cancer specimens. Adv Exp Med Biol 593:54–65[Medline]

Fackler MJ, Malone K, Zhang Z, Schilling E, Garrett-Mayer E, Swift-Scanlan T, Lange J, et al. (2006) Quantitative multiplex methylation-specific PCR analysis doubles detection of tumor cells in breast ductal fluid. Clin Cancer Res 12:3306–3310[Abstract/Free Full Text]

Fackler MJ, McVeigh M, Mehrotra J, Blum MA, Lange J, Lapides A, Garrett E, et al. (2004) Quantitative multiplex methylation-specific PCR assay for the detection of promoter hypermethylation in multiple genes in breast cancer. Cancer Res 64:4442–4452[Abstract/Free Full Text]

Foekens JA, Rio MC, Seguin P, van Putten WL, Fauque J, Nap M, Klijn JG, et al. (1990) Prediction of relapse and survival in breast cancer patients by pS2 protein status. Cancer Res 50:3832–3837[Abstract/Free Full Text]

Fraga MF, Esteller M (2002) DNA methylation: a profile of methods and applications. Biotechniques 33:632–649[Medline]

Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molloy PL, et al. (1992) A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci USA 89:1827–1831[Abstract/Free Full Text]

Greenspan EJ, Jablonski MA, Rajan TV, Levine J, Belinsky GS, Rosenberg DW (2006) Epigenetic alterations in RASSF1A in human aberrant crypt foci. Carcinogenesis 27:1316–1322[Abstract/Free Full Text]

Guarino M, Rubino B, Ballabio G (2007) The role of epithelial-mesenchymal transition in cancer pathology. Pathology 39:305–318[CrossRef][Medline]

Han W, Cauchi S, Herman JG, Spivack SD (2006) DNA methylation mapping by tag-modified bisulfite genomic sequencing. Anal Biochem 355:50–61[CrossRef][Medline]

Hanson JA, Gillespie JW, Grover A, Tangrea MA, Chuaqui RF, Emmert-Buck MR, Tangrea JA, et al. (2006) Gene promoter methylation in prostate tumor-associated stromal cells. J Natl Cancer Inst 98:255–261[Abstract/Free Full Text]

Henrique R, Jeronimo C, Teixeira MR, Hoque MO, Carvalho AL, Pais I, Ribeiro FR, et al. (2006) Epigenetic heterogeneity of high-grade prostatic intraepithelial neoplasia: clues for clonal progression in prostate carcinogenesis. Mol Cancer Res 4:1–8[Abstract/Free Full Text]

Hoque MO, Feng Q, Toure P, Dem A, Critchlow CW, Hawes SE, Wood T, et al. (2006) Detection of aberrant methylation of four genes in plasma DNA for the detection of breast cancer. J Clin Oncol 24:4262–4269[Abstract/Free Full Text]

Hui R, Macmillan RD, Kenny FS, Musgrove EA, Blamey RW, Nicholson RI, Robertson JF, et al. (2000) INK4a gene expression and methylation in primary breast cancer: overexpression of p16INK4a messenger RNA is a marker of poor prognosis. Clin Cancer Res 6:2777–2787[Abstract/Free Full Text]

Jones PA, Baylin SB (2002) The fundamental role of epigenetic events in cancer. Nat Rev Genet 3:415–428[Medline]

Lehmann U, Kreipe H (2004) Real-time PCR-based assay for quantitative determination of methylation status. Methods Mol Biol 287:207–218[Medline]

Lehmann U, Langer F, Feist H, Glockner S, Hasemeier B, Kreipe H (2002) Quantitative assessment of promoter hypermethylation during breast cancer development. Am J Pathol 160:605–612[Abstract/Free Full Text]

Lesche R, Fassbender A, Juenemann K, Foekens JA, Martens JWM (2006) Epigenetic methods and nucleic acids for the detection of breast cell proliferative disorders. Patent WO2006008128

Lewin J, Schmitt AO, Adorjan P, Hildmann T, Piepenbrock C (2004) Quantitative DNA methylation analysis based on four-dye trace data from direct sequencing of PCR amplificates. Bioinformatics 20:3005–3012[Abstract/Free Full Text]

L'Honore A, Coulon V, Marcil A, Lebel M, Lafrance-Vanasse J, Gage P, Camper S, et al. (2007) Sequential expression and redundancy of Pitx2 and Pitx3 genes during muscle development. Dev Biol 307:421–433[CrossRef][Medline]

Li H, Fan X, Houghton J (2007) Tumor microenvironment: the role of the tumor stroma in cancer. J Cell Biochem 101:805–815[CrossRef][Medline]

Liu L, Wylie RC, Hansen NJ, Andrews LG, Tollefsbol TO (2004) Profiling DNA methylation by bisulfite genomic sequencing: problems and solutions. Methods Mol Biol 287:169–179[Medline]

Lodygin D, Diebold J, Hermeking H (2004) Prostate cancer is characterized by epigenetic silencing of 14–3-3sigma expression. Oncogene 23:9034–9041[CrossRef][Medline]

Maier S, Nimmrich I, Koenig T, Eppenberger-Castori S, Bohlmann I, Paradiso A, Spyratos F, et al. (2007) DNA-methylation of the homeodomain transcription factor PITX2 reliably predicts risk of distant disease recurrence in tamoxifen-treated, node-negative breast cancer patients: technical and clinical validation in a multi-centre setting in collaboration with the European Organisation for Research and Treatment of Cancer (EORTC) PathoBiology group. Eur J Cancer 43:1679–1686[CrossRef][Medline]

Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R (1995) Genomic sequencing indicates a correlation between DNA hypomethylation in the 5' region of the pS2 gene and its expression in human breast cancer cell lines. Gene 157:261–264[CrossRef][Medline]

Muller HM, Fiegl H, Widschwendter A, Widschwendter M (2004) Prognostic DNA methylation marker in serum of cancer patients. Ann N Y Acad Sci 1022:44–49[CrossRef][Medline]

Nakayama M, Bennett CJ, Hicks JL, Epstein JI, Platz EA, Nelson WG, De Marzo AM (2003) Hypermethylation of the human glutathione S-transferase-pi gene (GSTP1) CpG island is present in a subset of proliferative inflammatory atrophy lesions but not in normal or hyperplastic epithelium of the prostate: a detailed study using laser-capture microdissection. Am J Pathol 163:923–933[Abstract/Free Full Text]

Nimmrich I, Sieuwerts AM, Meijer-van Gelder ME, Schwope I, Bolt-de Vries J, Harbeck N, Koenig T, et al. (2008) DNA hypermethylation of PITX2 is a marker of poor prognosis in untreated lymph node-negative hormone receptor-positive breast cancer patients. Breast Cancer Res Treat 111:429–437[CrossRef][Medline]

Paez JG, Lin M, Beroukhim R, Lee JC, Zhao X, Richter DJ, Gabriel S, et al. (2004) Genome coverage and sequence fidelity of phi29 polymerase-based multiple strand displacement whole genome amplification. Nucleic Acids Res 32:e71[Abstract/Free Full Text]

Pakneshan P, Szyf M, Rabbani SA (2005) Hypomethylation of urokinase (uPA) promoter in breast and prostate cancer: prognostic and therapeutic implications. Curr Cancer Drug Targets 5:471–488[CrossRef][Medline]

Pakneshan P, Tetu B, Rabbani SA (2004) Demethylation of urokinase promoter as a prognostic marker in patients with breast carcinoma. Clin Cancer Res 10:3035–3041[Abstract/Free Full Text]

Rakyan VK, Down TA, Thorne NP, Flicek P, Kulesha E, Gräf S, Tomazou EM, et al. (2008) An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs). Genome Res 18:1518–1529[Abstract/Free Full Text]

Robertson KD (2005) DNA methylation and human disease. Nat Rev Genet 14:597–610

Rodriguez-Canales J, Hanson JC, Tangrea MA, Erickson HS, Albert PS, Wallis BS, Richardson AM, et al. (2007) Identification of a unique epigenetic sub-microenvironment in prostate cancer. J Pathol 211:410–419[CrossRef][Medline]

Ruibal A, Schneider J, del Rio C, Arias J, Nunez MJ, Piqueras V, Tejerina A (1999) pS2 negativity in post-menopausal women with ER+PgR+ infiltrating ductal breast carcinoma is associated with reduced hormone dependence and increased proliferation and aneuploidy of the tumors. Int J Biol Markers 14:186–188[Medline]

Schwartz LH, Koerner FC, Edgerton SM, Sawicka JM, Rio MC, Bellocq JP, Chambon P, et al. (1991) pS2 expression and response to hormonal therapy in patients with advanced breast cancer. Cancer Res 51:624–628[Abstract/Free Full Text]

Shinozaki M, Hoon DS, Giuliano AE, Hansen NM, Wang HJ, Turner R, Taback B (2005) Distinct hypermethylation profile of primary breast cancer is associated with sentinel lymph node metastasis. Clin Cancer Res 11:2156–2162[Abstract/Free Full Text]

Soltermann A, Tischler V, Arbogast S, Braun J, Probst-Hensch N, Weder W, Moch H, et al. (2008) Prognostic significance of epithelial-mesenchymal and mesenchymal-epithelial transition protein expression in non-small cell lung cancer. Clin Cancer Res 14:7430–7437[Abstract/Free Full Text]

Srinivasan M, Sedmak D, Jewell S (2002) Effect of fixatives and tissue processing on the content and integrity of nucleic acids. Am J Pathol 161:1961–1971[Abstract/Free Full Text]

Tanaka K, Okamoto A (2007) Degradation of DNA by bisulfite treatment. Bioorg Med Chem Lett 17:1912–1915[CrossRef][Medline]

Tetzner R, Dietrich D, Distler J (2007) Control of carry-over contamination for PCR-based DNA methylation quantification using bisulfite treated DNA. Nucleic Acids Res 35:e4[Abstract/Free Full Text]

Tost J, Dunker J, Gut IG (2003) Analysis and quantification of multiple methylation variable positions in CpG islands by Pyrosequencing. Biotechniques 35:152–156[Medline]

Tost J, Gut IG (2007) DNA methylation analysis by pyrosequencing. Nat Protocols 2:2265–2275[CrossRef]

Umbricht CB, Evron E, Gabrielson E, Ferguson A, Marks J, Sukumar S (2001) Hypermethylation of 14–3-3 sigma (stratifin) is an early event in breast cancer. Oncogene 20:3348–3353[CrossRef][Medline]

Witz IP (2008) Tumor-microenvironment interactions: dangerous liaisons. Adv Cancer Res 100:203–229[CrossRef][Medline]

Woodson K, Gillespie J, Hanson J, Emmert-Buck M, Phillips JM, Linehan WM, Tangrea JA (2004) Heterogeneous gene methylation patterns among pre-invasive and cancerous lesions of the prostate: a histopathologic study of whole mount prostate specimens. Prostate 60:25–31[CrossRef][Medline]

Yan PS, Venkataramu C, Ibrahim A, Liu JC, Shen RZ, Diaz NM, Centeno B, et al. (2006) Mapping geographic zones of cancer risk with epigenetic biomarkers in normal breast tissue. Clin Cancer Res 12:6626–6636[Abstract/Free Full Text]

Yang WH, Wu JR, Wang TH, Au LC (2007) Methylation profiling using degenerated oligonucleotide primer-PCR specific for genome-wide amplification of bisulfite-modified DNA. Anal Biochem 369:120–127[CrossRef][Medline]

Zeschnigk M, Bohringer S, Price EA, Onadim Z, Masshöfer L, Lohmann DR (2004) A novel real-time PCR assay for quantitative analysis of methylated alleles (QAMA): analysis of the retinoblastoma locus. Nucleic Acids Res 32:e125[Abstract/Free Full Text]

CiteULike    Complore    Connotea    Del.icio.us    Digg    Reddit    Technorati    Twitter    What's this?

This article has been cited by other articles:

				H. Chai and R. E. Brown Field Effect in Cancer-An Update Ann. Clin. Lab. Sci., January 1, 2009; 39(4): 331 - 337. [Abstract] [Full Text] [PDF]

This Article Free Full Text Free Full Text Abstract Full Text (PDF) Free Full Text All Versions of this Article: jhc.2009.953026v1 57/5/477    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dietrich, D. Articles by Kristiansen, G. Search for Related Content PubMed PubMed Citation Articles by Dietrich, D. Articles by Kristiansen, G. Social Bookmarking                         What's this?

Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact